Description :
From Genome Similarity Track
Location :
Scaffold_22:204983- 206479
Transcript NameFunction/comments
Phyca_LT1534546661amino acid/auxin permease-like protein

Sequence
1496 bases(100 bases per row)
gccagaaggcgttcctgaccatggaagatgccaagaccatcttcaacatcgtctgctgcttcttcggtatcggtaccctgtccatgccgtccaacttcgc
ccgtgctggaccagtgtacggcaccatcgccatgctcttgatggcctttgccaacatctacgccacggtcgccctgtccaaggtgatgctggtggcaccg
gcgtcggtccggacgttcacggacgttggcgcgtgggtcttcggtactcccggccgctacgccgtcatgatctcacagttgctcgtgtgtctgctactac
cctgtgccttcctggtgctcggtagtacactactggacgtgctgttcccggactcgttcagccagattttctggatcgtcttcatggccatcaccgtcgt
gccgtcttgcttgatcccgacgctgagggatgctgcatcagtggcgttcgtcggctgtctcggcacgctcattgccgacgttgtgggcgtgagcattctc
cagtgggagatgcgtgaccacccgtccattccgacgccggacatcacgctgcaccaggtgctcaccacgttcggcaacctgtcgttggcctacggcgcgt
ccgttgtggtgccggaccttcaacgccaacactcggagcccacgcgcatgccgcgtatcatccttgtcagtctgggagctggttcggctttcttcttggc
catcgccatcgccggttatgccgccggtggctgtcaactatccggtaacctgctcttctccgtcgtgaacgtcgccgacccgagtgtcgcgtccgctctg
ggcttcatccccaaccgcggcgctgtcatcatggcgtacctgttcatgcaggttcacattgtcatcgccttctcgaccgtcatccagccgccgttctacc
tagccgaacgcttcattctcggtatgcacaaacatacatcggagacgctcgttccggaaggcgagaagctatcgacggccggttctcccgtggtcactgc
cgaccaggtaacgcccgaccttgaaggcaactacaacgtgtccaacacgcccaaccggctattgaccgctgaccaacagcgtaaggataaggaggctcag
gagctctctgagtatgaaggcaagggaacggttctacgctacgtgactctacgtctgtgcatcattgcggtgctcgtggcggcctctatcggtctgcgcg
accacttcctcgacctcgtggacttcacgggcgcgtcggctatcacggtctgctgtctcgctctacctattgtgttctacctcaagacgttctggaccga
tctgcccgtgtacgagcgcgtggtggccgtcctggtgatcatcatctgcagtgtcgtcggttgctacgtcatgatctacgccggcaagaacctcttcaac
ccggacacggagaccgccgtgttcccgttctgctccgtggaggaccaaatggagccgtacttcgtccggaacgccacgacgtccaactaaagtgta