Description :
From Genome Similarity Track
Location :
Scaffold_107:204926- 207669
Transcript NameFunction/comments
Hyaar_Emoy2809702putative endo-1,3-beta-glucanase
Hyaar_Emoy2809703general transcription factor IIH subunit, putative

Sequence
2743 bases(100 bases per row)
TCATTATCCAAAGAACAAGTCGAACATGACGCGTGTATCCATCTTGTCCGCCGCCGCTGGCATAGCCGTGCTCGTGTCGTCGTCAGCGGCGCTGGACAAG
AAGCTCTACGGCATCAACTACGACCTGCGACAGCACCCGGACTGGGTTCCTAGCAAGTGCAAGTCGGCACAGACGATCGAAGCCGAGATCTTGACTCTAA
GCGCCTACATGTCCAGCGTGCGCACGTACAGTCTCTCGGACTGTGACGTGACGAGCGTGCTCAGGGCGGCCAAGAAAATGTCAATTACCGTGTGGCTCGG
CGTCTGGGTGTCCGAGGACGAGGAGGTGTACAAAGCAGAGGTCAAAGCTTTTGAGCAGCTCCTGAGTGCCGGTCTCATTGACAGCAACGTCGTAGGCATC
AATGTTGGCAGCGAAGCCGTATACCGGAAGGACATTACGGCTGAGCAGTCGATTGAGTACGTGACTCAATTCAAGAAGGTCTTGGCCGACAACGACATCC
GCGTGCCCATCAGTATTACGGACATTGCTGATACGTTTATCCAGTACCCCGAGATGCTCAAAGCCGGTGACATCGTGACCATCAACCAGTTCCCGTTCTG
GGAGAAGGTCGAGGCAAGTAAGGCTGCAGCCCAGTTCGACAAGCGTATCGAGCCTCTATTGAAGATGGCGGGCGACATGGACGTCATCGTCACTGAGACG
GGGTGGCCGACGGACGGGTTTGCTGTCAACGGATCCGTGGCGTCCGCGGAAAATGCCGCCATCTACTTGAAGGACTTTTATGAGCTCGCCGAGTCGAAAG
GGTGGAAGTACTACTACTTTGTCGGCTTTGACACGCCTTACAAGGCGAAGCAGGTGGATGACGCGACCACGGTCGAGTCGCACTTTGGCATTTTCGACGA
GGCGGGGCGCATGAAACCGGCCTACGAGAGGCTCACCCTCACCACGAAGGGTGACTCGTCGACGTCGGAGAAATTAGTGACGACTGCCTCGTTCGATTCG
TCGTCCCCGTCAGTCGACCCAGGCACGGTCACTGCAGCTACTGACGTTGCCGACGACGACACCCTGATCAGTACCCAGTCGTCGTTGGACGCCGACGAGA
CCCCTTCGTCTACGATCACCAACGAAGACAGCGGATCATTGCAACTGGCAGTCTCCAGCATCACGGCTTGTCTGTGTCTTGTGGTCACCATGATCTGGAA
CCTATAAGGTCGTTCACTTTAGTCTGTCGGTTGTCTGCTACACACCTGCTAGTGCATATAACGCGATCATTAGGGTTTTGATGTAGTAGGGTAGGGATTA
AAGTGAATGAATCTGTTAAAATAGAGCCCTAGGATAGTGTGGTTCACATAATCGATATCTATTGTGAACCCATTCGTAAAATGGAAAATGCGACGATATC
GCAAGCGCATAACGCTGGCAGTAGCGAGCCGTCAGTCGAAGGGCTCTTGGTCCTTGTTATCGACACGAATCCCGTGCACTGGTTTGCCCAAGCAGCTGGT
ACAGCTGATCGAGCCGGTCTGCAGCGTCTCATCTCCAGCACTTTGGTGTTTGTGAACTCGTATCTGCTACTGCACCGTAGTAATCGGATTGTTATTATCG
CGGCTCATGCTGGCAAGAGCGCCATGCTGTACCCAAATCCAGAGCAAGAAGACACTTCAGGGAGTGCCGAACAGGCTGCGAAGGTCAATGCTGGCGTCAT
GCAACGTCTACAGGAGCTCAGCGACGCTCCACTAGACAATGCTAAGACAAATCGAACAGCCATTGCGGCGTCATTGTCAAGGGCCCTCTGCTGTACGACA
CTGCAGTGCTGCGCTGAATATGCTATGCTAGGATGTTGAGGTTACTGATGGTGTGCATGTGTTATTGTATGCATGTACCCCTAGTCATCAACCGTGCCAT
TCATGAGGATCCAGAACTACGACCACGGATCTTGGTTATCCAGAAATCTCCCGATGTGTCGGAGCATTATATCGCCATCATGAACGGCATTTTCTCGGCT
CAGAAGAAGAACGTGGCAGTCGACGCGTGCATACTTTCGTCCGAGCAGTCGTCGTTCATGCAACAGGCAGCCTATCTTACGGGTGGTATCTATTACAAGC
CCAACGACCACAGTGGCTTACTCCAGTACCTGATCGCAATCTACCTGCCGGATCCATCCATGCGCAAGTTGCTCAAGCTGCCATCGCAGGACTCGGTCGA
CTTTCGTGCCATGTGCTTTTGCCATCGAGAGGTGATCTCGACAGCGTTCGTCTGCCCCGTGTGTCTTTCTTTGTTTTGCGAGTTCCGACCGATCTGCTCC
ACCTGTGGCATCCGCAGCCACATCCAGCCGAAGAAAACAGGTATGCTCAAGAAACACTTGCGCTATGATTAATAACATGCTGACGACCCACGATCTTTGA
CCCGATAATCAATTGGTACTCCGTCTGTCTGTCGACTGGCCTGGAATCTAATTGGTCGATAGTGTCACGGTAGCAAAATCAAGATTATGCGCATCTGCTC
GACTTGTGGCTGGCCAGAATTGTGTCTGCTGCCTGCTTTCAAGTCCTTTTAACACATTTGCAAATTGCGTCAGACTCTAACTAGCCGCGTATCCAGCAGA
CCTCAGTATTATGACCAGGTGCACTCACACTTGACCTGTATTTGTACGTTTTAAAGCGACCTTTTCAGCTAATTCCATTGATGTCACTTATGTATAGACT
GACGATTGCAGAGGTTTTTGCCGAGCGCAAGGCCAACAACACG