Description :
From Genome Similarity Track
Location :
Scaffold_1411:2049- 3125
Sequence
1076 bases(100 bases per row)
CAGGACGAGACAGCGTACAAGGCTGTCAAATTCAAAAAACTTTACACCCAAGTTTAACGGAGCTTTAGAAACGGTGAAACGGTCCCCGGCTACTATAAAG
ACACTAAAAATTATCTTCGTGCGCTGTCAGAGCCTCAGCATACCGCTGACTCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGATGCCC
CACAGTCATTCAAAGTGACCACGGTTTCTCAATGCTCTTAACCGTTTCCAATGCAACCAACAAGCCTGACTTGTAACACGCTTCGTGGTAACATCCACGA
AATCGTTTGGGGCTTAGCCCTGTTTAGCTCTACCTCCTGGAGCCTNNNNNNNNNNNNNNNNAGTAGGGAGCCCACGCTTACTGGGAGTCGACATTTTCCC
GTACCGTACCATATTTATGGTTGGGAGTGGTATTACGGCTCGGCCGTCTCTGTCGCGGTTTACGCAATGGAGAATTTAGGGCGGAGATGCTTTGTGCTTC
CGCATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGGCTTCTCCATCATCCTCAAGACAGAGATCTATGGGCTCATCCT
TGTCAAACAATGTTCTGGGCATGTCCATACGTACCATAGCGAGTCGCTTTATAGTTTATCTCGGCTTTTAACGCCATGTCCACCGCCTCCTCAACGGTTA
AGAGATCGACGCGAAAATTTTCTGTCCTGTCGACTCCAGTACGAAGACCTTCCATAAAAAAGTTAGGCAGAATCCCTAATAGAGAGGATCCAACTGCATA
GCAGCGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACAACTCCTTCTCCTCTTGTCTGGAGGATAAAAAGCTTAAACACAC
TCGATATGCCTGATTATGCGATGCAAACACGCGAGACATCTGTCTCTTAAGCACGTCCCACGTGGAAAAAGTGACGTCTGCAGACGCGTCACACGTCAGA
GTTTATTCTCTGGCCCTTCCGACAAGTTTTGATTTGGCCAAGCTAACTCTCTGCTGCTCGTTCTGCAGCATGGCGG