Description :
From Genome Similarity Track
Location :
contig_4:204881- 206290
Sequence
1409 bases(100 bases per row)
TCGACACCACAAGGCAATGGTAAACGCTTTGTATCGGCCGAGCTTGGACTGGGGCCTCACAACTTTTGACAACATTGGGCGAGCATTTTTTACAATTTTC
CAATCCATTACACAAGAAGGCTGGACTGGCATCATGTACATGGTGATGGATTCATCGCAGCCAATAATCGGAGCGGTTTTTTTCGTGGTGCTCATAATTT
TCGCGTCATTCTTCGTGATGAACTTGACACTAGCAGTCATTTCCGAGGAGTTCAATCTTGATCAGAAACCTGGAAAGACAGCGGCTCAGAAACGAGAAGA
CGAGAAAAGGGCGAAGATTGAGAGAGAAAAGGCCGATAAAAGGGCTCGCGAACACTGGCTGAATGCTATTGTGTCTCATAAATTGTTTGCCGCGTTTATT
ATGGCTGTGATTCTTGCAAACACAGCTATTTTAGCACTCGACCATTACCCAATGCCTACTCCATGGACGAAGATCTAGAAATTGTAAATTTCGCGCTCTC
CTGTGTGTTCGTCGTGGAGATGGTGATGAAACTATTTGGTCTTGGGTTACGCCAATACTCACGCGACAGGTTCAATTTGTTTGATGCATTCATCGTAACA
ATGGGAATACTGGAGACTGTTGCATCCCCGCCATCGTTCATGTCGAATAATCCCCCTAAAAAGGGAGCAGTGTCAGCGTTGCGATCATTTCGGCTTTTTC
GTGTCTTTAAGCTCGCTCGAGACTGGAGATCGCTTCGTGAGCTCCTTGAAATGATCATTCGCGCTGTTGCGAGTATTGCAAACTTTGGCGTGCTTCTCTT
CCTATTTATCTACATCTATGCCTTGGTGGGCGTCCAGGTAACCAGGCTGAGCAATGTTCTTCAGCAAAGGATGAATATTAGAACTAACTTGTGCGTTGTC
CTGTTTACTGTAGTTCTTTGGCAACACCATGCGCTTTGATGATGAAGGCTATCCAACACCGTTCACACTAGAAGGGTTCTGGGCTGGAACCGTAAGGAAT
CATAATTTGATTTTGTACGTAGCAATGACTAACAACTCTCAATCGTGACCAGGTTCCGCGAAACAATTTCGATACCTTGCTGTGGGCTGCTGTCACAGTC
TTTCAAATTATTACCGGGGAGAATTGGAATAACATCATGTACTTCGCTATCCTCGGTAATGGCATGCTTTCGTGCATTTACTTCATCTCACTGGTAAGTA
CTTGCAGTCCTGCTTCGTTCACTACTAGAACGCAGTCCCTAACCCATGTTTGGCTGTACAGGTGATCTTAGGTGATTTCGTGCTTATGAATCTGTTTCTG
GCGCTGCTACTCGACAACTTCGGCGGCGATGGCGACGAAGAGCAGGCGATGGAAAAACAAGAAGAAACAAAAAAACTCGCCCAGAAGATGTCCGTCATGA
GTATGAAAG