Description :
From Genome Similarity Track
Location :
Scaffold_48:204824- 210008
Transcript NameFunction/comments
Phyin_T30-4PITG_16575Crinkler (CRN) family protein

Sequence
5184 bases(100 bases per row)
GAATCCGTTTTGGATACCAAGCTGAGCATTATCAGCAGGGTCCGCGATGCAATAGCGGCGGCCCAGAATAGACAAAAGGAGTACTCCGACAAACATGGAA
GAGGAAACTGAAGTGTATTTAAAGTGGGGGGGTTAGTGTTACTAGCCACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCATCAACAAGCTGAA
GCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGCCCTCCCTAAGTCAATGACGGCGCACCCGACGTTCTATTTT
GGACGCCTTAAGCGGTACTTTGATCCGCAGTGGTTGCGGGCTCGCAGACCCACCTTGGCCCAGCTCCTCGAAGCGAGAGCCGACCACAGACGTCGACGAA
GGCCTCGGAGCAGGCACCCAAGCCTTGGTCTGAACGGCAAGGTTGCGGTCAAGACTGTACGCTGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACG
CCGAGTACGTTGAGTACGCCGGGTACGCACCATACGCGTACGTCGGGTAGTGCGTCGAAGGCGGCCCCGGACGTGGCAACAGACGATCCGTCGGATCATG
CGGAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGATGCAGGCTCGCGAACTCACGCTACAACAGGTCCAGGCGGGCCGCAAGAC
GAGCGAGATCGCCCTGATTCCCGGTCTGGGCGGGAGCATCACCGCCAGTCCTAAGGCCAAGTGCAATCTCAAGCACGAGGACGCGTTGACGAAGGCGGTC
AACCTAGGACCCTACGTCGGACCAACAGGAGAAGCGCTCGGTCAAGAGTAGCGTCCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGACACCTCTGCCC
CTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGAATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTTCTCGTGAAGTGGAGGGGTT
ATGCCCACACCGAGAACTCGTGGGAGCCGATTGAACGACTCCTGATTGACTGCCCGAAAGGTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAA
GTAGTCCGGGGCTTCTTTCCCGAACGGGGTACGGACGTTGAAGACACTCCTTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCACGCTTCAGGGTGTCCC
TTGGCAGCATGCGCTTGCTGGAAAATTGAACACGAAGATCACGGTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCTGTAACTCAGTGGG
TGAGTACTTGAGAGACTCCACCCAAGCCCAGAACATGTCCTCACGAGAACGCCAGGTGGGGGCATTTCTCGGGCAGAACCCAGATGTACCCCCCAAAGAG
GATAGAGACCACCCCGGTTCTCGGGCTTCTTACGACACGTAGTGAAAGCGTTAAGAGGGATGCAGTGTGGCGCGAGAAGCACGCACCGAGCCGCCTCCAA
GCTGTCAACAAACAACTGTTCCTTCTGGGCAAGAGTACGTTCGTAAATGCCCCTAGAGGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCC
AGGAAGAGGTCAGCCCCAGAGCTCTCCTTGGGAGGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAGCCCCCACGC
GAACGCTGGGCAGCTTGTAAGTTCTCCTGCTTCTGGTCGAGGTCATTAGTGATCTCCCGGGGCTCCAAAATAGCACCCTCCTCCTCATCCTATTTCTCCT
CCTTCTCATCCTCTTCACCCGAGGAGTCAAAGAGGCCCCGATGGGGGTACCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTCGAAGCCATACGCTTCTT
AGAGGGCTTGGCGCCTTCGGCTTTCGCGGCCTTAGCACGAGCAAGTTCCTCGTCAAGCGAGAGACGGTTGCCAGGCTTACCCTCCTCGTCGACACCAGCT
TTGGGAGTGCCCTTAGCCTTGACGGCCGTTATCTCAGAGCGCACCGACGTCCTGGGACTTTGATCACCGTGATCACTAGCGAGCGACGGCACGCTGTCGT
CTTTGTGCTCGCTGGGCACTGGGATGTGCCCTCCCGTAGAGCCCACAGGAGCATCGTGCGTGCTTCCGGACTCGGCTTCGTCCTCACTGCTGAGTCGAAC
TGACGTTCAGCGAACCGAGGGTTCGGACGGTTGTCTGGGGAGGCCGAGGGCGACGGACTGCGGCGCTTTCTCGTTCTCTTGGCCACAGCGCGTCACCCGT
TGAGCCGATCTCTTCGGAGGCCACCTTAGTAGCCTCCTGGAGTGCCAAGCTTTTGCCGTGAGAATTAGTGCTCTTGGCTTGCGCCTTTCCGGCAGCAGCC
CTGGAGCGTGTCTTCGCACCGCTCTTCGCAGTGCCACGAGTCATGACAAACAGTCGAAGCGGAGACCAAGAAGAGGAGCGCACAGACTGCTGCTCGAGGC
TTTAACTGTGAAGTGAGCCTCAGCCGCGCTCGCGCTGCCAAGTCGATGTTTTTTTACTTTGAGAATGAATAAAATTTTGTGACGTACACTTCTTCATTCT
GATTGGTCGGTAAACCGAGCCTAAGTGGTAACGGGGTACGTAGCCCTAAGTGTACCCCTAGTTACATGAAGTGTGACACGTCATACTTCGGGATGTTTGG
TACAAAGTACCAAGGTTGTCCGAGGCCAACCATTGGCGGATGACATTGCTTTTCTATAGGTGACTACTTGTTTGTATATTTAAATCAAGCTTAGCCTACC
TATAAATATACTCAGCTTAAACCCTCCCTTTAATTGATCACCTCGCTCCCTTTAAGTAAAAAGAGACCTGTGGACTGCCGCTCACTGAGAGTTTGTATAA
GCTTACTCTCGGAAACCAACTTCCTCTACTGTGTGACCCCGTCACAATATTATTTGTGAAAAGGAAGCTGCTTTTAAAAACTGCTTTTAAAATGAGTATT
CGATTCGAAACGGTTATGACAGGGTAAACGAAATCGCTGGACTAGCACATAAAATCCAGAGAACGTGTGCAAATACCCCCTTCTTTTCCCGCGTGCAACC
TTATCTCATTCCAGAATCAGCGGCTCGAGGAACTATGGTTACTTTGTACTGTGTCGTCGTTGGTGTGGCTGGGAGCGCGTTCCCTGTGGACATTGACGAG
AACAAGTCCGTGGGGCACTTGAAGGACGCGATCAAGGAGAAGAACGCATCGACGATCACATGCGACGCCAAGAACCTGCAGCTCTTCCTGGCAAAGGCGG
CGGGCAACGCATGGCTGTCGAGCCTCACTGAAGATGTGAAGAAGCTGAAGAAGGGCGAGAAGACTGCTCTCGTCAAATCTCTAACGCAAGAAGAAATGGA
GCTGCAGGGAGAGTCCGGCCTCAAGAAAGTGCTGGCGGGGATGCTATCGCCATCCACCGATGAAATTCACGTGCTGGTGGTGGTTCCGGAGCAAGACGGT
ACTATCTCAAAAGAGATGTCTGCAGTGACAACGCCACTGACTGTAGAGCAAGTGGAGATGTCAATGAATAAGGTTCTCAGGGAACGCGATGAGAAGGCGT
CTGCGTATTCGTTTACCGATCTGAATACTGCGATGGAAGAGCGAATTGTCAAGGAGATGCGCTTGACCGAAAATATTCCTGATGTCAAGGAGCCAGTCGA
TACTTCCATCGCCGGTTATTCGTGGATTCCAAAAATCGTGGAGAGCGAGGAAAGTCAAAGGGCTGGGTACATGGCGTACTTGCAGCAGCATTTCAAGACG
CTGATCGATCGAGGAGACTTCTTGTTGGATGACATTGCGGGCGATAAATCAGTTCTTAACATCGTGGACCCAAGACTTCCGTTTGCTATGAAAGGCACAG
CTGATGTATTGCTCATCAATCGAACAGCGAAGAACCCACTGATTAAGCTGGCTGGGGTCAGCTTGGTGATCGAGCTCAAGAAGAAAGTCGAACCGGGCCA
TGTTCCTCAAGCAATTGGTCAACTTGTGAGCTGCAGCATGAAGGCGCCTCTCAATTGCTATCCGCTGAGTTTGTTGACGGATTTAAACGACCACTGGCAT
TTCTCTTGGTTCAGCGACAAGCACGTTCTGACCCAACTTACGTTAAGGTATCCGAAGAACGCGTTCAGATTTATCGAGGCAGCTGTACTGAGACGAACGG
AGTCTGCCCCACCTCCTCCGTCATTCATGCCTGGATCTTTCAAGACAATCAAGGTTGATGACTTCTTGCCCCAGCCAGTTGATGCTCGTGCAGAGGAGAT
GATGGAACGATACGAGTTGATGGCAGATGTGGTGGAACCAGAGTTTCTCATGGCGAGGCGGATGGATTATGCGCGACAGTTAGTCCAGTCGATGCCTATG
TACTCTTACATGTATACGTAGTTCGTCGTTTCGATCTTAACGAGTCACTATCGTGACTGAACTTTTATCGTTGTGTTGTATGTGCCAATGCTTGCCTAGG
ACTACCAGCTTTTTAACTTTTCTACCCTGAAAAATATAAAATTAATAATAAACAAAGATGGAGGTAAATTCACATGAGCAATACCAAGAGTGCATGAATG
CAGCGCAGAAGCGCTACTACCAGCGCACACGCGAAGCGCGCAAAAAAGCAATTGTGAATTTCCGACCAAATTCGCGTTATGCTCTTACAAAATGAGGTCG
AAATAACATGAAATTTGTATTTTGAGTGACTCACTAAATAGGTAGCGCCCCTTCTGTGACATCACCCTTCTTTTCCCGCTTAGGTACGGGTGATACATTT
TCAAGAAATTCTCTCTCCCCCTCCCTTTTTCCACATTCCAGAATCCATCGGCTCGTGTAGAGATGGTGAAGCTTTTCTGTTCTATTGTTGGTGTGGCGGG
AAGCGCGTTCTCCGTGGAAGTAGACGAAGGCAAAACTGTGGATGACTTGAAGGAAGCGATCAAGGCGAAGAAGGCCAACGACTTCAAAGAGGTTGATGCA
GACAAGCTGCAGCTCTTCCTGGCAAAGAAGGACGAGGGTCGCGGGTCCGTGGCTGACTGAAGAAGAAGTGAAAAAGGATGTGATTGATACGACTGGTCTG
AAGCTGCTGGGAGCGGCACGAGCAAGGCTACGACGTGTGGGGTTGTCGGATGTGGATGTCGGGTGGAGTGGATGAAGACGAAGA