Description :
From Genome Similarity Track
Location :
contig_60:204794- 207310
Transcript NameFunction/comments
g9090.t1hypothetical protein

Sequence
2516 bases(100 bases per row)
AGAAAATACATGAGATTACCAAGCACCTGCTCGTTCTTGGGCACGGAGCGGAGGGTTGCTTTCAGCAATGGCGGCAATAGACCTCTGCTGCTGGCTGCCA
GTCGTGATTGCGACCATAGCCATAGAAAACCGGCAACATCTTGCGCATCGTGTGCGACGTTTTGTGGTCTTTGAAATTGTACACGCGTTGCCACTTACCG
TCGACGTTGGCGTAGCGGTGCGAGATCTCGCAAGCTTGCGCTGCTTTCGAACCAACAACACAGCCATCAAGTTAGTCCAACCGTGCAAAGCGTCCGCGCT
CAAGCAAAGATGCCTACCATTGCACGCGGCGCATAAATCGTAATCGCTGCAGATAGCGCAGTTAAATCGTGGTCCGGTGAAATCTGTTTCGCCACACGAA
TCGCAGATAAAGCCTAGATGACGACCGTCCATGATGTAGCGTAAGGTAGCAAGCGGATCCTCGTGGCACTTGCGGAACGCACTGCGCACGCGGAATTTTG
GAATGTCCAGCTTCTCGGCCAGGTTTTCAACCAGTTCTAGCGTAGGCGGCGCCAAATCGGTAGGACTGAACAGTTGTCGTGCTTCTGCATAACGCTCGAG
TAGCAGCTCGTACACGGGGCTCAGGGCACTCGCAGGTGGCACTCCGTGGAGACCTTGTGGTCTTACGCAGAATACCACAATATCCGCTTGCTGCAATCCA
GCACTTTGAGCCGGCGCATGGTACGGGATCAATTCAGAGACAACAGTTGGGGCAATTTCTTCTCGGAACATTTCCAGCTGTGCACAGCTCCAACCTGTAT
GACGAGCAACTGCCTCGTACAGCACACTGGGCGCGAGTCGTCCGCTTTCAGACTTGCCTCGGATTGTCGTGCCGTCGGGACACAATGTTTCAAAAACACG
GAACTTGCCGATATAGTCTAGCTGGTTGGCAGGAGCTGGCTGGAGAAGCTTTACAAACACATAGCCTTCAGGGGTCGCCAATAAATCCTTCGCAGTCGCT
TGGGCACCAGGCGGTAGATCAAGCGGGAGATCATTCGTCACAGAATTGTTTTCAACGTATATCTGACAGAACGAATACGCGTCGATGTCAACTCCATCGC
AGAGCAAGTGACCAAAAAGAGGTCGATCTTGCTGGGATTTGTCACAGGCGAGCAGTTTGCGTGGCCGCAGTGCCTGACCTGACACCACTGGCTGGCACCA
CACTCGCGTCTTGGCCATCGCTCCTTCTTCACTGTAGTCCCCGAGCACTTCAGGAAACCGGTCGTGTAGTGCGACGAGCAAGTCGCGTAGTGAGCAGCAG
AAAGGCAGCTCCAATTCCGCCACGTTTGTAAAATCTACGAGTCCGAGTTGATGGTGTTCTCGAAGATCGTGCTCAAATATCACGCGAAATGTAATGGACA
TGAGTCGAACCTGAGCAGATACAGTGAGGATATCGGGTTCGGTTTGGCCCTCCGTGGAGTTGGTAAGAAAACCTTGCTGAGGATCACGCAGCGTCGATAG
AGAACCAAGTGAGTGCACCCCCAGTTGTTGAGGTGTCGGTGAAACTTGTTGTCCGTTAGACACGAGTGCCACTCGAGTCGACGTCTTGGATCTCGTGCGT
TTTCCACCTGCAACGAGAACACAGCGCACGTGAGCCAGTCCGGTGCACGCCGCGATAAATCAGTCAGTACAAGGTACACGCTGAGTACACGGTCCTTGTA
CTGAGCCTCGTTTGGGTTTCCATTTGGGAACACCCATAGGCAAAAGCGATGCGCGCCAATGTTGAACGTGTCCGACACCACCTTGTCCACGCTTCTCATA
GCTTCCACGTCCGTAAACTTGGGTATTTTCACGGACATTTCTGCTCTTTGTTCCATGCCGTGTTTTTCCTCATAGCAGCGTCTCCAACAGCCTCCATACA
GCCTCACCAACTAAAAAAGTCACAGGTCACAAAAATATCAATATCTTAGTTCCAGCTCTCTCTGCTTGCACAAAGCTCTCAAAAGACAGCATTTCACCCG
TACATCATAGTCCGGTGCCCCGGGTAGTTGTGGTAGCAGCTGCGTCCTCAGCGTCGGCCACCTTTTCAGGCAGATCCGCTTCCACACTTGTCGGTCGAAC
GTGAGCGTCCGGAAGGTTCTGCAGGTCGCGGCGCACGCCAGCAGTGACTGGCCGTCCAGCTGGGCCAGCGCCAGCAGCTCGTCCGGCAGCGTCTGGATGT
CGCTGGAAAGGTCGTCCATGTCCACGTCGTCCAGATCCAGGCTCTCGCTGTCCGTCTCGCCCGCGGAGCCCTCGCTGACTCGGCACTGAAGCAGCCGCGG
GTGCTGCGCGCGTCTGCTGCTCTTGCTGGAGACCGTTCGGGCACCACCGATCCACTGGCGCTTCTTGGGGCTGAGCGCGCGAGCCGATGCGACCATCGCA
AAGACGCCGGATGAAGACGAATGAGATTCAAGTTTGGATCCAAGAAGAAGCACTTTGATGGAAAACTATGGAAACATATTGAAGTTGGTGTGGGAGCACA
TAGAAATGATGTTGGG