Description :
From Genome Similarity Track
Location :
Scaffold_1191:2047- 5314
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1191-snap-gene-0.3Endomembrane protein 70
Pytar_ATCC12531maker-par_contig_1191-snap-gene-0.4Pc22g17490 protein

Sequence
3267 bases(100 bases per row)
GTCGTCAAACGGCACGAGCGTGTCGTGCGAGCCGTGGGAAAGCATGAACGGCGGCACGCGTTGGTCGCGCCGGAACTCTTTGAGCCGGTCGTCCGTCAGC
CAACTAATGGGCGAGGCCTTGTCGTACTCGAGGCGGGCGTCCAGGAACTTCTTCTGCATGATGAAGAGCTCCATGAAGCGCACAAAGCCGTGGCTGCCGT
CGCGCGCATAGTAAATGCCGTGGCGGTCGGTAAAGTCGTGGACGCCGTAGTTGTCAATGCAGCCCTGCACGCTCGTGTCCACCTCTTCGAAGCCCGGCTG
AAACGACTTGTCCGTTGCCGTGAGTGCCACGAGGCTCGCCAAGTGGCCACCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACAATAAAGTCGGGGTCAGCGTTGAACGCACCGCGCGCGTTCTTGCGCAAG
TATGCGACGGCTCGCTTGACGTCAGTGAGGTGGTCGGGGAACGCCGNNNNNNNNNNCCAGCCAGCGTTCGCGCACTGGTAGATAATGGGCATGGGCGCGA
GGCTGCGTGAGCCAAACATCCACGCGCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGCGCGT
CTCAGTCGTGTGCTTGTACACGTTCATGCGCAGCCGTGTCGTGTTGTGGTCGCCTACGTGCGCGTAAGTGACTGTGCGCGTCAAGTGCACGCCGGGGAAC
GCGAGCGACAGTGCCATGGGCTGTGGCAGCGGCAGCAAGATGCCGAGCCACTTGGTGAGCGAGAGCTCCCCGAGATTCGCGAGACGTTTTGGGTCGATAT
CGGACTCGGTCATGGCCACGCGGATGGCGTCTCTTGCCGCCACGTTGGCACGGTGGAACCGCATAAATTGCAACATCGCGACCGCCTGGAACAGCGCGGC
AAAGGACCCGGTCCAGCCGTCAAAGACCGCGGCACGTGACTTGCGCAGCCAGTAGAACAGCCCGACGTTCGCGGCTAGCAGCTTGTGCGCGAGCTCGGTG
GGCACGAGCGCCTGCGAGAACGCGATGACATTCTGCGCTCCGCGAAGGGAATCCGAGGTGAGTATACGACAGAGAAAGGAGCGAGTAGAACGAGAAAGCA
CGCACCTCATTGGCGACGTGTTTCTTGGCGCCGCGCTTGGCCATGTGCAGCATGAGCAGCGTGAACGCGAGGTACGCCGACGAGACACCATGGCGCTGCG
CCCACGATGTGACCGGCCCTGGGATGATCTTCATGGCGAGAGAGAGAGAGAGGGGGGNNNNNNNNNNCGTCACCGGGAATATTGTCACCCTAAATGACGC
AGGTCCATTCGGCAGAGCATCAATAAGCCTCGTAACCTTTCACGGTGATACCAACCGCTTTGTTACAAAACCAGGTAAAGTACATTCTATTTTGCGTCAA
GATAGTTGCNNNNNNNNNNTCCGCTTTGTACAAAACCAGGTATAGTAAATTTTATTTTGCGTCAAGATAGTTGCACAATCCACCGTGTTTTGTGAAACGG
ATGGGGATTGAGTATTATCTTCCATATTCACCCAATCAAACGCGTTATTGAAGTACAATATCGACCAATCAAACGCTTTCAGAAGTGTTGACGTATTCCT
TTAGTCGAACAAAAACAGGCACTTGAGCCGACAAAGTGACGGCACAACGTCACATAAAATGGGTTCACCTGCGTCCCCTCCGGCAAAAAGATCCCATCGC
CGAGAGACGGCATCGTCAGCTCGTGGCTTCAGTGCGACAAGAAGAACGGTGCCCCCTCACGCACCGCTGGAGCTTGTGTTCTTCCAGAACGCAGACCAAG
AGGAGAGAATGTGAAGGCTCCGGAGAGCCCAGAGTAATGGGGTCGGCCGTTCTTGCTGGAATACAGTAGCAGTGCTGCGTGAACCCAGTCAAGAGATGCT
GCCGTGTGCGCCGTCTCGTGCCTGTGGACATTTCCGGCGTTTTAAGTCGACGGAACGGTACTTCACGGTCTCTTAACGCAGGAAAGCTATTTCAGGTCCT
ATAGTTGCCGGATGCTCCCTCGTGCCATGGCATTGTGAGCTCAAGGGATACAAACTGCTGCTGCTTGGCGATTCGTCAATTGCGAAGGCGCCGCATGACG
ATGCGTGGACTTTGTTTGCCACGGCCAGCGTCATGGCGGGCGCTCGCTCCACGATTGTCGCTCAGTACCAACGTAGAACGAGCACAACGCCAAGGGAAAT
CTCAAGCGAGGCAGACCGACGCGACGTTTCTCATTCATAGTTTGTTAAGCGGCGACGGTCAGGGTCAGATTCCTTCTTTTCGTGTGGCCACAGGGACCCG
CTCGGGCGGCTGCCACAGACCGAGTCGCAGACTACTGCCGCTGACCGTGCTGCTACTACTGCCGCATGCGACCAGCATCGATGCGCGTGACGAGGGCCGT
TTGCCGCCGAGCGTCGAGAGAGCCGCTTCGAAGCGCTCCAGTGCATTTCGCAGTTCGCGTGGCAAGAACACCACGTCGAGTGAGTGCTGCAGCAGACACA
GCACGCTGAAGGGGGCCTTTGTCCACGCTGCAACCAGCTCACGATCGCGCTGGAGACACACAGTGAGGTCCTCATCGTGCGGACTGTCTCCGAAGAGCTC
CACAAGAGAATAGAGTAGATCCAGCGGCGACTGGCTGATCTTGTCCATCGACACGCACCGGCTCCGTAGTCCCGGGACGCCAGCTTGACAGACACTCTCT
AGTAGACTGCCGACGCGAGCGTCTTCGTCCATGAACGTGTGGCGCACTTTGGTGAAGAGCCACGTTGCAATGGGCCGCGTGACCGCTTGGTGGATCGCCA
CGTACAGTCCGCGCTCGAGCTGCATCGCGCTGTCGTCCAGCCCCGTGAGCTGCATGAGCTCGAAACTCTTTAGCACGACCAAGTCGCCCTTAAGCGCGTC
GACAAAGTTGCGCACGCTTGCCATGACCACGTGGCACGCGGCACGGCACGCCGACTGCTTGAAATCTTGGTGGAACTTGCGGATCCGTTGCGCCAGTGGC
TGCAGGTCGTCAGCGAGCAGCGCTTCGACCGCGACGTGGATTCGCTCAGACACGTCCCGTGTCGAGACTAAGAGGCTACAGATCTCACTGAACGGAAGCA
GCGGCGGCCCGCTGCCACTCATGCCGTCCGAAGTACCGGTCCCGGTGCTGCTTGGCGAGTTGCGTGA