Description :
From Genome Similarity Track
Location :
Scaffold_7:204689- 205706
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05046hypothetical protein

Sequence
1017 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCCCCCTCCCTCCAGCCGATG
GAGTACAACACCCATAGCTGAGTTGACCGCGCACTGGACTTGCAAGTTGGCCCCTTTTGACGGTGGCATCACCACGCCTACCGTACACATAGTAGTTAGT
CTCATCAAAGTAGATAATACAGCCACCGTCTTTTTGATAGTCCTTGAGAGCTTCCGCGAACTTGAAGCGTTTGGTCTTGTTGATGTCATTGTTGCACGTC
ATGGGCTCGATGCGTGTCTGTTTTACCGTGTACAACATGCCCAGCAAGTGGCGGCAGATCGTTGAGGTGGAGACGTTAATTTCCGTGTCCAAAAAGAGCA
TCGTGCGCATAGCTTCTAATGTAAATGTGCAATTCTCGTTGAGGTACTCTTCGAGCTTGTTCCTGGCCTCTTCTGTGATCTTCACGACGCTACCCCGAGC
GCCGCCGCGTGACACATCCTCCACGCGTCCTGAGGCGACAATACGGTAGGCCACTGCTCGCGAAATGCCGTTGTTCTCGGCCACCTGAAGCCAGTCAGTT
TGGACGGGCAAAGGTGT