Description :
From Genome Similarity Track
Location :
Scaffold_7:2046884- 2050839
Sequence
3955 bases(100 bases per row)
CCTTGGATCGTCGACGTGCCACTACGCTGCTTCAGTTGCTGAGCTTCGCTCGCGTGCCTCGGCAAAGTGAGCAGCCACAACAGCAGAGCCGACTGCATAG
CGTACGCAATGAAGGATGTCGCCATTATTTCGTCCCGGGCCTGAAACGTGTCCGACGTTCGTCGAATTTCGACAGCTCGAGACCAAGAGGGCCCCGACAC
ACTCGTCACCAGCCTGCCCATGGCCCAAACGAGTGGTCGGATCCGTCACCTCAGTCGCCACGACTGTGTAGTCCAGAGCCGAAGGAATAGCCCTCATCAC
GGGCAAGCCGACCCATAATCACTGACTGCGTACGAGGTCCCAGATCGTGAACATCGTAGTGCCTACATGCATGACGAGTGTAGTGATTGTGCCTATGACG
ATAACAGTACCGTTCCAGCCCTTCTCGTCAACCCAGTTTAAGACCACACTAAGTGCCACAAAAGACACCGCAGAGGCTGCACGCCGGCATAGTAGAATGC
CGGCCCTGACACCAGCAAAGACACCACCCAAGAACCGATATAGCAGGACGTGATTCAACTCATTGTTGGAAACCATCGATCAAATCTGGCAAAGTGCCTC
ACGAAGTGAGCATCGATCAGGCGCAGTTTCACTCACGGTGAAGCCTAGCAGCACCACCGGAATCAACTGTATGAGCCCAACAATCAGCACCAGCTGCGTG
TAAAAGTCAAAGTTTCCTTCATAGTCCGTTCCGCTCAAACCAAACCCCATAAACAAGTAGCTCGGCAAAGACTCAGTATGTTGTTATAATAGGCTGAAGC
ACCACGTCTCCGTCGCGCTGGGAGCTAAGCGCACCCAAGTGGTACGTCTCGACGTCACTGAAAAGATCGCCAGCCACCGCATCTGCCAATGCGTAGCCTA
CAGAAGCCACCGACATGAGCATAGCGTAGAAGGCGCCGTGTGATGGAGCGTCGAGGTTGATCTTGTTCATTTGCTGTCGCTGAGTGGCGTGCCGACCGTC
TTGCGGTCTTGGAAATAAGGCGATGGCGATCAGTGCGACAGCCGCCACCGTCCATCCCACATAATTGTCGACCGGAGACGTGAACAGCGTGAAAATTGGG
AGGAATTTCCATAATCCAGTACTAGTGAGCTTGAAAATCGGCGAGATGAGCATGTGTCCAGTATCCAACTAAATGACAATTTTTAAAATAGGCATACATG
TACTTTCCACACACTTAGGGGTCAAACAAACAGGTACATTAATGAGAGCTTATGCAATGACCATCAGCTCGATCCGAAAAGGGACGAGGAGAGCGGTGCC
CCCATTAATGGTCATGCAGTCACCCTCACCAATGCATTGTTGTGTCCCCCATTTGTCCAGCTACCATATTTGCTGACAGCGCAGTGATGGACTCCTTGCA
GAGTCGAGTGTACGTCTTGTACGCGTCAGATACCCATCGGCCGTGAAACTGAATCGTCAGTGCATCCACGCCGGAGCGGTACATATGGGTCGCCCCGCCT
GCGCGAAGGGAGTGTGTACTAAAGTGGTGAGGGTTCTTGCCGGTGCGGACGGCAGCACGCTTTATAGCTTGGGACAAATCTTCAGCTGAAACGCAGGCTG
CGACTCCTCGGTGTGATATGAGCACCGCGGCTGGAATGCTAGCCGGAAGACCTTTCCTTGCTTGAAGAAGTACAAGAGATCCGAAAACAGGGCAAAGGAA
GTGATGGCCAGAGCGTGAGAGCATTCTTGTCGTAGAGGTTCCGCCTTGGTTTGTCTTCGAACCGATCAACCGTATCCACACACCCTGAGCTTGCGATGGA
TCCTGGGTTGGCCTGCCCGTCGCATCGACAGTTATAATGTCTTCAGCTCGAAGTGCAGACCACTTGAAAGAACCTCCTCGGATTGACACGATCTCCGATC
GATGTAGGAGGAAGAAGTACGCCAAGCACATCGCCCCCCATAAAGCTTGCTCACGTGGTGTAGCCATCGTCAAGCTGCGAAAGCAGGCTTCCAGAATGTC
GAGTGAAACCGGTTCCTTACGAAGCCGCGGTGTATCGAGACGGCTGATACCTTTGAGAAGCATGCATGTAGATTACATTTCCGTAATGCCGGCACAACGC
GCACCGAAGAAGGAAAAGAGAGATCTGCATGTGCCAAGTCTCTACAGCATCTTTCGATGGAAGTACATGTAACAGAGCAACATTTCTTCACTGACCAACA
TGACTCCTTGCCACATTTTATTCCTGTACCTTCAGATAAGTCTGGGAAACGTTGTTTTGACTGTAATTATTTACATGTACACACCAGCGTAATCTTCGCC
CGTCTCACCTATGCACAACCTTGCAGTGCTATTAACATGTTTAATAAATCCAGTGCCACTGGGCGAGTGCAAACACGCTGTTGGCTCATACATTGAGAGC
ACGTGAGCCGCCACAACAAAAAGGAAAAGTCACACCGAGCAGTATCAAGAGACTCAGGCCTTGGATCGTCGACGTGCCACTACGCTGCTTCAGTTGCTGA
GCTTCGCTCGCGTGCCTCGGCAAAGTGAGCAGCCACAACAGCAGAGCCGACTGCATAGCGTACGCAATGAAGGATGTCGCCATTATTTCGTCCCGGGCCT
GAAACGTGTCCGACGTTCGTCGAATTTCGACAGCTCGAGACCAAGAGGGCCCCGACACACTCGTCACCAGCCTGCCCATGGCCCAAACGAGTGGTCGGAT
CCGTCACCTCAGTCGCCACGACTGTGTAGTCCAGAGCCGAAGGAATAGCCCTCATCACGGGCAAGCCGACCCATAATCACTGACTGCGTACGAGGTCCCA
GATCGTGAACATCGTAGTGCCTACATGCATGACGAGTGTAGTGATTGTGCCTATGACGATAACAGTACCGTTCCAGCCCTTCTCGTCAACCCAGTTTAAG
ACCACACTAAGTGCCACAAAAGACACCGCAGAGGCTGCACGCCGGCATAGTAGAATGCCGGCCCTGACACCAGCAAAGACACCACCCAAGAACCGATATA
GCAGGACGTGATTCAACTCATTGTTGCAAACCATCGATCAAATCTGGCAAAGTGCCTCACGAAGTGAGCATCGATCAGGCGCAGTTTCACTCACGGTGAA
GCCTAGCAGCACCACCGGAATCAACTGTATGAGCCCAACAATCAGCACCAGCTGCGTGTAAAAGTCAAAGTTTCCTTCATAGTCCGTTCCGCTCAAACCA
AACCCCATAAACAAGTAGCTCGGCAAAGACTCAGTATGTTGTTATAATAGGCTGAAGCACCACGTCTCCGTCGCGCTGGGAGCTAAGCGCACCCAAGTGG
TACGTCTCGACGTCACTGAAAAGATCGCCAGCCACCGCATCTGCCAATGCGTAGCCTACAGAAGCCACCGACATGAGCATAGCGTAGAAGGCGCCGTGTG
ATGGAGCGTCGAGGTTGATCTTGTTCATTTGCTGTCGCTGAGTGGCGTGCCGACCGTCTTGCGGTCTTGGAAATAAGGCGATGGCGATCAGTGCGACAGC
CGCCACCGTCCATCCCACATCATTGTCGACCGGAGACGTGAACAGCGTGAAAATTGGGAGGAATTTCCATAATCCAGTACTAGTGAGCTTGAAAATCGGC
GAGATGAGCATGTGTCCAGTATCCAACTAAATGACAATTTTTAAAATAGGCATACATGTACTTTCCACACACTTAGGGGTCAAACAAACAGGTACATTAA
TGAGAGCTTATGCAATGACCATCAGCTCGATCCGAAAAGGGACGAGGAGAGCGGTGCCCCCATTAATGGTCATGCAGTCACCCTCACCAATGCAGTGTTG
TGTCCCCCATTTGTCCAGCCACCATATTTGCTGACAGCGCAGTGATGGACTCCTTGCAGAGTCGAGTGTACGTCTTGTACGCGTCAGATACCCATCGGCC
GTGAAACTGAATCGTCAGTGCATCCACGCCGGAGCGGTACATATGGGTCGCCCCG