Description :
From Genome Similarity Track
Location :
Scaffold_62:204617- 207847
Transcript NameFunction/comments
Phyin_T30-4PITG_18427Putative uncharacterized protein
Phyin_T30-4PITG_18428Putative uncharacterized protein

Sequence
3230 bases(100 bases per row)
TTGGTAGACGTCCAATGCGGGGTCCAAATATACTGCCCAGCCGGCGTAATTATGCATAGATAAATTCATCATTGTATTATGCAACGTGGCTAAAACAGTT
ATTAATAGTGTCTAACATAAAAAACTATGAAATGCACACATTTATAGCGCAAGTGAAGGAGTTTCCCACAAAACGTCAAAAGGAAAAACGAGGGAGAAGA
CAACAATGGAGGGATGGCGTCAGCTTTCTGTACAAAGCTCTCAAGAAGCATTTGAGGTCTTTTGCGAGGATTCGATGTGCTGCTCAGCTGTTTTCTTAAA
ACGCGACTTTGACGTTTGCCGGATTTGTGGAGGTCAGCACATAATGACCGAAAGACGACTTCAGTACACTAGCAAGAGCTGTAGTGGTAATGGTAATTGT
CTACTCCTATGGAAAGTGTTCACTTGCTCTGCCCAAGACACACGGACTATTTGGGTCAATCATCATGGCCACGTTCGGGGTGTCTTTCCTTGCTCAGCAG
CGCACCCACATCGAATAACACTTGCTATGAAGACGTTCCTAGCAGCGCAGGATGAGATAGGGATACCACCGAGGCTCATTATGGTAAACTTGAAAAGGCA
AGAGAACATGCAAGTGACTAGCCGTGGGTGGCCAGACCTAAAGCAGATTCGAAATGCACCGAAGCGAATTCGACGTGAGCAAGGATCCAAAAACTCACGA
AAATCTATACAGGATTTGGTGCGATTACGAAGCTACTGCCCTAGCTTGTCACCAAACACAGCTTTTTTGTTTGGATCTAAGATGGACAGAGAAGGCTATG
CCTACGTCGGGTCCGGGAGTGATGCTCATTCGTTCATAATTAGGATTTCGTCATTGGCAATGATAGATGCTTGTTTGCTATTTTTTTAGCGATGAATAAT
GTCAATTTCATTCTGGGCGCGACCTTCAAGCTCAGCAATATCGGATATCCAGTTATTACCTGCGGCTTAACGGACAGGTCTAGAGCCTACCAAGTGGGAG
CATTTTTGTCGTTAGCCGGAGAACAGCCTTCGAATACACTGAATGTTTTCGAAGCTTCGCATACTTAGTACAAGAAGTACGAAGAAAACCGCTGCGAGTC
TCAGCAGTAATGGGCTTTGCTGAGGATGCTCAGTACCTAGCTGTCGAGTCCGTTCCCATGTGCTGAATCAATGTTTTTTTTTCACGTACTCTATAATGTA
CGTAAGCGTGTTCAACATCTTCCCATCAAAGACCGCCATCGTATAATGGGCGCAATACTGGACATGCACTTCTCCAATAGCTACGAGGAATTTAACTTCA
CCAAGGAAGCCGAAGTATCGAAGTGGAGGGCGGTGACACAACTTGCCTCGTTTGCTGACTACTTCGAAGCGCAGCGGCTTTCAGGTCGCTATTGGCAGTG
GCAAGCATATCAAACGCCTACAGGACTCGCTTCAACGAATAATCCATGCGAAAATCTGAATGACGCCCTAAAGCGGTTTCTGTTGAGACGACGCTATCAC
ATGCGAAAGCTTCTGTTAAAACTCTTTGACTTCATCGAAACAATCACTCCTTTAGCCCCGGTCAGAGAAACCCATATTCCAAAATCAACATCGGATATTG
TGAAGACAGCGGCTGCAATGGCTGAAGCCTCTCGTGTACAGTTCACAGCAAGCGGTAGATCGAATTGTTTTCTCGTTTACAAAGTATCAGATAGTAACGA
AGCCGATATCGTAGAGGAGTACAGGTCTGTATTCGGAGAGAATGCACAATCCGAAGTCGCGGATACATCATCGGGGCAAGAATCTTCATCCAGAGCAAAC
AGTTTGTTTCTGGCCCTAACGTCAGGTGTTGAGTCGAATAATACACATACGGATCATACATCGAACAGCGATGACGAGGAAGAAGGCGACAGGTTGATGG
AGAATCTTGATGATACGAACGATGAAGACGTTGAAGAACTCCGTCAATACTACAGCAAGGTTTTAGTATGTGCACACTTAATTGCTGCTGAACGAAAGTA
CAGTCCATACACTTACAGACGAGACCCTCTCGAAAAACTGAAAAAAACGTATTACGGCGAAAGTCCAAACAAAGAGGAGCTGCTCAAAACAACTCCGACC
AAAACCAAAATCCAAAAAAGCTACTGCACGACCTTCCCAAGTTCGTTCGAAGGCCAAAAGGAAGAGGTCGATTCAGCAACTTTCAGCTGTGTCACAATCC
AATACGCCAGACAGTACTGACCCACCCCATTTTACACTAGTCGGATGACCTCCAAGTGCTTCTCCAGCGTTAACCATTCAATTTCATTTAGAAGAGTAAA
AAATATAAAAGTGAGACTTGAGCATTGCATACAGTTCCGGAATCCCAATTGTTTTTCCAAAACAATTGTCAGTTGGATGCCATATAGCGGCATCAGGATC
GCGCGAAATACTTTTGTCTCGCCACGTAGCGTACTTCTAACACACACCTTTTGTATGTGTCGAACGCCTTCTTTATTTTTGCCTCAGCAAACTGTGCTGA
TGGCTCTTCAGATTCCGAAACGACCTCAGGCTCAAAGCGTATAATTCCCAGAGCAGAAGCAATGACATCGGTCACCCTGCCGCACACGGCTGCGAAAGCT
TCGTCAGGTGTTGTAGCACGATCCTTCGAGCGAGCAAATAGAATTGCATGTTTCATACTTAGAATCGTTGTCTCAACAACTCCGCTAAAACCGCCCCGAT
TGTACTCGGTCTGAAGCTTGAGGACATGCTCTCTAGAAGCGAGAAGATGGTACGATGACCGAGCTGCCGACAGAAATTCAAATTGTCTTTGTAGATCGGG
ATCCTCGTTCTCGGAGTCAATGTTGTCGTTTGCGGGGCTGTTTTGAAGCATGCGCTTTGAACCACGCTGCTGAGATGATCTACGCCTCTCGTCAAATATC
CCGTCGAATCCGGATGGAAAGGTTGGATCAGGATGCTTCTGCATCATTGGCTCACGGTCATGAAGCGGAACTTGATACCGGAGTTCTCGTAAGCGCCTCC
CGCCGTGGCCTCGTAGCCATTTCGAATCCTTCTTCAGCCGGTCAGTGCCGGTGGTTCCATTACGCAGCGACGCATACTTCCGCGCGTGGTCATTTCCGCT
GCGTTCTGCAAAAATCCAGACAGCTTCGTGGATAAGCATCGATAATTGAGACCGCCGCAGGTGAGCGTAAATTGCAGAATGAGAATATCTTCAATCCAAA
GAGGATGATGATAAGATTCAGAGACGTTAA