Description :
From Genome Similarity Track
Location :
Scaffold_80:20457- 24513
Transcript NameFunction/comments
Phyke_g3623hypothetical protein PHYSODRAFT_485908

Sequence
4056 bases(100 bases per row)
CCAAAAAGCACAGGCATAGTAATTGCCTTCGAGGTGCGATATCGACCTCCGTCAACGATCACCTGCTTTAGTGCCGAGTAGAGAACACAACTGCATTCTC
GGAGCACATCGACGGAGTACAAACCTTTGCAGACTTCCCATGTTGCGCATCCGTTTTCATCGGTAGTGACAACTTGCCGCTcagagctgcagttgtcgGT
GATCTGAAGAGGAATACCCGAGAGCTTGATAATTTTATTCGGATGAAAATAATCCACAAGCTGAAGATTGTAAGTCCAACGAAAAACATCAAGCGGAATA
ACCACTTCCTGCACTGAGtttgacgatgttgaaggaCCGCTGTAAAGTCCTGAAGCGGCGATTGTTGGGTAGACCGCGGCAAGTGATGTCCACTCGAAGT
AGTCCAAATGAAATACATATAGCGAATAACTGCCAGGAATGAGGCGGCAGCTCGCCCTCCCTTCGCTATCTGTCACGTAAAGCTTCCTCCGGTCTTTGAC
AATTGCACTAGTGGGATTTTCTGATGACTTGGCATCTTCAGTTTGAGAAGTGGTTTGGTCGACTGCAATCATTGTTTTCTGACTTGGTTCGTTCGCAGCA
GTATGCATTGAAATCTCTTCTTGTTGCCCCTCCGTATCGAGTCCAACCAACTCATTTTCCCATGTTTTGAGGAGTGTTTGGTCGTCGGGTGTAGCCGCTT
GGTTCGGCGGTGTGTCTCTGTGGAGACTTTGCTCAAGTATCACAAGCTCTTCTTGCGTTGAATTCTTCAACAAATCACGTTCGCTGTCTGATAGCACCAA
AGCGTTCGCGCAAAGACGCTGAAGTCGAATGGAAAGGTTTTGTGAGTACTTTCGAGCATGTTCACTTTTGCGGGCGCGCTCGATAATGGAAGCTTTGATT
TTCTCGTAGCGTTGGCGCATGACCTTTCTCAAGAGTGCTCGCGCTCGAATCACAGAGATGATGTTTATGTTCAGGCTGGTAGTGATCGCTGCTTTCTTGA
TGCCTTTTGAAGTACACTCAGCAACAAATGTTATCGACAGCTGCCGCGTGATTTCCTGTgctctcttcttctgcaatCGACGTCGGATTGACATAAGCCG
AGAGTTCATCATTAGCGTCGGTAGCACGGTTTTCGCCAAGTTCGAGCTTAATGCATCGAACTCAATGTTTTTCTCGATGAAGATATGAACTTTCTCCACG
GGCGTATTGGTTTGAGCACTGACAACTCGAAACTCGACATGTCGTTTTACCCTTTTATTCTGCGGGGCAAACGGATTCTGCTGAAGACATTCCTTGATTC
CATGTTGGGCTAAGATGCGTAACAGGCTGCGATAGATGGATTGGATGGTTGGCAGCGGTCGATTCGTAGAGCTCCAATGCGTGTACACGTCCAGCTCATT
ATCCATTGCCTGCAGTTTCAATGTTATTCGTAACGGAGACCGGTTTAAGGCCGCATCATCTGTCAATGGCACTAGCACGATACGCCCATTTCGTCCAAAG
CGAATGTTTTTGGCTAGACGACGAGCAAATTGTTCACATTCACGACCTTCAGTTGTTGTGCTTTCTCCTTCGGTCGCAACAGCTAAAAAGTGGACTCGAA
CTTCATATGTCTGGATAATATGGAGATCGGCTAGCAAAACATTTACTTCATCGATGCTAGCATAGATCGATGTAGCATTGCCACATCCTCCAACTGCCTG
AAGAAACCACATAttgttcttcttcgagcGATATGCAGCGGCCAGCGTGAACCAGCAACATTCTTGATCAGTCCTCACGTCAAACATGCCCATTATGTGG
CGTTCCTCGACGTTTTCCAGTTGAATTTGCACTGACGGCTTTCGGTTGTGCAGAGAAATAGCACCACAAGAATCGGTCGCACCCTCTTTCTCGTCTTCCA
CAACTTTTTGAAGTGAAAACAGTACGCAGAAAACGCGACTTGATAAAGCAGTGAGACGCAGGTATACACGATCTACAACTCCATTGTAGATGGATTGACC
TTGGCGATAGGAGATACCTCCACGTTTAGTTACCGGACATCCTTCATGCACGAAatcgacgagctggaagtcGTGATCTACCAGAACAGAGACAAAACGC
CACTGAGATTTGGATACGCTGTTGCTTTTCGCCATTGTTGATGAGAACAAAAGTGTGTTCATGAATGGGAGTGTGTACAATCCTGTAGGTGTAGGAGTCA
GCATTGACAAGCTTGGCAGATCATCCATTCGGTGGCTTTGCGCGTGAGAATAATTGTCCTAGCCATCgtagcaaaacaaaaacaattgACGTACAGTCAG
AACATCTGGTGGTTCATAGCTCGTAACAAATATCGTGCAATACCTGGATGCGTTTGAGGTAGCCCACAACTTCTGGTAGCTCGgatgaggagaagaaaaa
gccAATTTTCTCGAATTGAGCTGACACTTTTCTCTCTGTCAGTACCAGCTTCCTGTTAATCACCGACTCCATAAATGTTCGCTCTCGGTTGTTCCTTGAT
TGACCTGCTAATGCCAGGAAGTGACGAAATGCCTGGATGTGTATTTCTTCACCCGGAGACCGCTTGGCCTCAAACAATACAACTGAATCGATCTTCTTTT
TGACGTCGTCGAGGTTTGGAAAGCATCCAGTCGTGACCATCGAGTGCAGAACGACAGAAACGGTAGCTTTGCTGGGGGCACGTGAAATCTCCATGCAGAT
CTCATATGTGCCGATACTTGCTTCGGCGTTTACCACAACGTTCAACAGGGGACTCATTTGTTCTATCCCAGAAACAATAGTCGCTGACTTTTGATCATAC
TCCACTTGAGTTCTACAAACATGATCGTGGCTGCGTTGAACACTGAACTCCGCGGCGTACTCGATAACCACACGGATGTCTCCTGCCTGTATTGCGGAGA
GCAACAAATCCTCGAACGATTTCGGGCTTGGAACGCCTATATCGTAGTGTGCCCCGTCAAAGAAGCTGCCCAGTAGCACAACCGAACCTCTGTTTATGGA
CGATCCACCACAAATTGATGATGTAAGGCGTGGTAGTGATGTCCAAATTGGAGGGGAGCATTGCCGCCAAAACACATTTCGATGGACGTTCACGACGTTT
TCATAGCTTGAAATGTCACGCACCGACCCGACTTCAGGAATTGATATAGAAATGAGTAGTTCATCCTGCCCACGTCTCGCTCCTAGCTCCGCAGACTGCA
GATTTTCTGATGCCTTCCATAGCTGGAAAGAAGAAATTAATCCCACAAAGCCGATCTTGGCACGCCAATCACTAACACTTTTAGCGTACGACGGATGTCC
TCCGATATAGACCGAGTTTGAGCTCGACGCAGCTTGAATCCACGCCGAATTTCCGTGTACATTCTGCCGCCGGCCATGGACACTGGTTAATGAAGGATTT
GGTGTTTCGACAGGATGAATACGTGCACAGTCCACCAGATCGTTATCGAAAAATATTTGAAGGTATCGACAATCAAACACAACCCGAAGATAAACCCAAT
GGTTGCTGGGGACTTCATAGTTGTTAGCCCAACATTCCCATCCTCGCCATCGCACATGACAGCCCCCATCCGCTCCTCTCTCATTGTCATTACAGAGAAC
CCCGCGATCATAAATGGAGAAAGATATTTCTCCGAGCCATGAATTGTCGCCGTGAAGTTTAGCTGCTAACAGTTTTGGTGTCGACTCGCTGGGTCCTACC
CCAACATCAGTCCCAAAGCAGATTAGTGTCATTCCACTTCGACGACAAGGGCATTCTAATACGCAGTACAACCTTGAGAGAGACCTGGCAATGCTTTCCG
CCTGCTATCATCGATTGGACTAGCGGAACAGCCAAAAATGCTGCGGTTTAAGCTGCCACAGCAGAGCCACCGCACAAATTCCCCATTATCATCCAGCTCT
GGGTTCTGATGACGAGCTCCGTCTGCCTCGCTATCGCAAACAGTTGTGCCGAACACAAACAACGTAAAACCATTAGCATGAAACGCGCAGAACCCTACTG
ACAACCCCAATATCATACACTTTGGCCTTTTGTTTCTCGGTGTCAGCAGCCTTGAA