Description :
From Genome Similarity Track
Location :
Scaffold_16:204540- 206695
Sequence
2155 bases(100 bases per row)
TGCTAATCCTTAACTTCTAAAACGTCTTGGGTGTAGCCAGGAGCGGGATCGCGAATGGCTGCAGACTGGAGGAGGTTTTGGTGGCGCTTGATTCTGTCGT
TTGGGTCTCCCTTGCTGTGAAGAGCCTGCAAGTGCTTAAGGACGGCGCTCGACCCACGCGAGCTGATCTTCTTCTCGCCACTTAGGAAGGTAAGTACGGC
TTCCTCTGCTTTCTTGCCCACCTCAAGAACACAGTCACGATAGTCGTCAGCATCTTGATCAAGAACAAAGCCGTCTTCAAGAAAAATCTTCATGAAGGCT
ACCAGCAACTTCGCTCTTGATCGCTTTTGTTTTGGCGCCAGAGCGTACCAGCGTGGATCTTGAGCGTACCACGCAAACCAGGTAGCATGAAGGTGAGTTG
GAGATCCCCGGCGCTGCTTCTTGTTTAGCGTGCTAACGTCATCTGTGCCTTCCTCTGGACAGCTTCGTTTTCTTGGTGTAGGCTCGCTGTTTTGCTTAGC
TTCGAGTGCATCTATGCGAGCGTCCTGTCGCTTGATGTGCTCCATAAAGTGCTTAATCACAGCCGCTTGGTGGTCGATGGTCTTCTGTTTCTCGCTTGAT
TCTCTTGGCTGTTCGTCGTCGTTGTGGATTGCTGCATTACCTGTCTTGGTGTCTTCGCAGGTAGCGGATGGGGTTGCCAGGTGCGAGGACCAAGCGAGCA
GCTCGGCTGGTGAGCATCCAGCGTAATCAACAGCCGCTTCGATGCGCGTCACAGCTGGACTTGTGGGGCTCAGGTCTTTGAGTAGCGGGAAGTGACGGAA
GACGCGTGCGGTGAGGACATCCATCACCTTCTTGTTGATGTTTAGGCTGTCGGTCTTGAGCTCGAAGCAGGTAGCAAACAGGACACGCTGCACCCGATCC
ATCCCTTGACGCGTCTGCGTGTCAAAGCTAGTCAAGTCTTGCAGCGGCACCGCGGTTCTGGGTTTGTATCCGCTGAATACTTTCGCTATCTTGTGGTCTT
CTTTGCTTGTATTGAAAATGTAATTGAACCCTTTGTTCGTTGTGCTTAGATTCCAGGAGCCTCTGTCAAAGATCCAGCGTGCAGTCATCTCGTCGCAGCC
GTTTGCGTGCTGAGCGCCTCCTCTTCGAAACGAGTGGGATGTCAAGGCGACAGCCACACCAGCAGCAGACGCTACACGGTCTAGCACCCGGTTAACGTGC
GCGTATACTGTAGGGGCTGTGGCAACGCGCGGCGGAGCTGCTGGAGCGGCAAGACCAGTTGTGACTTGCGGAGCGTTGAGCAGCTCGATCAGCGGGACGT
CGGGAGAAAGCGTGGAGCCTGCGAAGCCTGCTTGTTCTGGGAGGTTGCTGACGAGGGCTGGTCCTGGGGCGGCTTGGAGGATCAAGGCGAGCGCAATGGA
GAGCAAGGGGCACGTAGCCAATTCCGTATCAGGAAAGAGCGACAGCCCCTGCTCCTCAGACGTCTTCACGCGAACCAAGCGCAGGAAGAAGACGTCGCCT
GCGTCCACTGACATGTTGTGTTTGCGGACCATGGCTAGGTCAGACGCGCGACCGAACAAGTACCAGAGAAGACATAGTAAAGTTGCATCTTGATAGTCAC
TTTCTGAGCTAGCATAAGTGTACAAATACAACATCATTCTTTTCAAATCATCTTTCGTACAAGGTGGTGCTTTCGCTACGAGCCCACCACCATCTCGCTT
CAGACAGAAGCTGTCTAGTGTCTTTCCCATTTTCAGCAACCGGGCTTCCAATGAAGCTCGGTGCTTAGGGAACTGGTCGAGCAGCCAAAGCTTTGCTTGC
CGATAGTACTGCATGGCAGTGTTGCGAGCTATTGGTTTACCTTTCTTTCCTTCCTTGAATGCAAGATACATACCAAATTTATCCATCACACACACGAACA
TTTTTCCGCTCTCGTCACTATCAATGCACTTCCTTATGTATTCCTGTTCAACTTCCTCTTCTTTGAGGAATTTGACGAACGCACCGATGGCTGTTGCCTT
AGCCCGCAAGGTGTTACCAGGCTGTAGTTCGTCTAAGCCCATGTCACTGATTCACTGGTCCGATAGAAGCAAAATATGCAAGTGATATGTCAATGACTTA
GAGTTTGGATACGCATACACATATTTTGCGGATCGATCGGACGTGATACGTCCGA