Description :
From Genome Similarity Track
Location :
Scaffold_939:2045- 4640
Sequence
2595 bases(100 bases per row)
GATCTGGAAGAAAAACCCCGACGAAGTTCATCCAAGATCACTCCTGCGACGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCCAGATATGGCGTTGAACACACTGGATGGAATCAATATGATTATACAGCTGCTGAAAGAAGCGGGATTCGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGATAGGATATCACATTTAATCGTCATAGTATGCCTCAGCCGAGTCTGAAATA
GAGTTAGGGGACTCAATCGGCATTCCGCGGATGTCTTTAGGTCCAGGTGGAGCTGCTCATCTGTGCGATCGCATGGAAAAGAAAGCTGATCTACGTGATC
GCGGGGAAGGGATTGAGAGCGGACCGCGATCAANNNNNNNNNNNNNNNNNNNNAGAAGATGCGGGTTTTTCGACTACCCAAGCACAACTACAATCATATT
TCGTGCTGCCATGGAACGAATTCAGCAGGAACACCGTAATCAGGCCCNNNNNNNNNNNNNNNNNNCCAAGAAGTTTACCCAAGTCAGAGGATCGAGGTTG
CAAGGAATATCGAGTCTTACACCCCTGATATCGAGATGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCAACTTAGGGCAATTCGAGCCAAGACGACCACTTGTGGCTATTGCGGAGACAGTGCCAGATAGTGGACTTAGCGCCCNNNNNNN
NNNTTCGGATGTCTGCAATCGCAGGATTGAAAGCGTTCAAGGGGAAGGAAAAAGACGAAGATCGAGCCAGGAGCTAGATCGGCAAGGTAAAGTCTGCTCT
CTTGCGTAATCAAGCCCCAGATGCGGAGAAGTGCTTTTTATTTGGAAATCTGCTTCCGGGTCCGGCGNNNNNNNNNNNNNNNNNNNNAGTCGATCCGCTC
AACATTCGTGGAAGGACCTATTGGAACGTTTTCTCGCGCAATACGGTGGTAATGGTATGTCCGTTGGAAGACAATAGTATCTCGACAAGAAACGACCAGA
GGAGACGCTTCTGGATTACCTGTATCATTTGTATTGGCAGAGAATCGAGCAAAGATACAAAATTGAGATGGACCCCCAGACATTCGTCGTGAGCATGTGG
AACACTTTATTGTGACCCCGGACGATCGTTATCTGGACAAGCAACTGAAGCTGTTACAGATCGGGGATGTGGATGATATGGAGAGACCTTACGCGCTTAC
CAGCGCATGGGTGATCGACAAACTCAATCACTTATGGTACCGAATAAATTTCGCCCACTATCCACACCCACAGCTTCTCCAACACCAGCTAAACCAGCGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTCTTCTTCCTCCAACCTTAGCGGATCGGAAGCGGAACGTGAACTACGTAATGTA
TTTGTGGCAGCGNNNNNNNNNNATCGCCCGACGACATTCGGAGATTAACGTGCTACAACAGAAGAGAATCGTCAAGAATATAGTCCGGATCGTATCGCGT
TTAAGAAATCCTGCTCTAGTTGTGGATCGAAGAGACACGACGATCGTGGATGCTGGAAGAGACATACTTGCCAGAAATGCAGTCGCAAGCGAAATCCATC
GAAATTTTTTCTCTATGTGTGTGCAGCTNNNNNNNNNNGTGAAGAGATGCATGAGAATGGCAAGTACCCCATGGAAGAGCTCTATAACTTGAATCGCAAG
TGGTACGTGCCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTGATACACTGTTGGAGGATGAAGGACTTAAGCATAGGCGCGATTCGATCACTAACATATGCGATAGTTCTACATTTGTTTCT
TCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAGGTAAGATATGTGATTGACGAGAGCCAAACGCAAGGATGTGTTGGGATCGG