Description :
From Genome Similarity Track
Location :
Scaffold_64:204460- 208339
Transcript NameFunction/comments
Physo_138530hypothetical protein
Physo_109149adenine phosphoribosyltransferase
Physo_109150PREDICTED: similar to ENSANGP00000020432

Sequence
3879 bases(100 bases per row)
GAGAGGACGACACTCAGCTGGCGGATGCCGACAACCGCGGCCAGGTGAAGCTGGGCAGATCCGTGTCGGCTCCAGAGCGTGGCACGAGCGTCGATGACTG
CCACGAGGCTGCAATGGCCATGATGGCCATGGTGGACGACGACGAGCACGCCGCATCCTGCCCTGAAGACAAGCAGTCGCCCCGCTCCGTCCAAACCTCG
ACTCGACTGAGGTCGTTCTCAAAGTTCGTCTACTGCTTACCTTCTTTGCCTTATCAATGAACAGGGCTCGCTTAACACTTGTATTCTCGTGTTGCTGCTC
CCTTTGACCAACAGGATTCAGGAGAAGGCGGCCATGAAGAGGCCCCCGCACAGACTCTCGCCTTACAATGACCCGCAGCAGCAGCTCATGACCATCGGGA
ACATCATGAATCCGCGCGAGCCCACGGAAGCGAGCGGCTCCTCATTCGGATCCCTAGGCAACAAGACTGCTGTTAATGGCAAAAAGCGGAGCATGCGTGC
GCTCTTCCCGGAGCTGTCCGAGTCCGAGCGCCGCGCCAAGCAGAGGCTTATCGTGAAGCGCTGCTACTACAAGAAGATCGTAAGTTCAACCGCGCCTGTC
AACTCCATTGTTGTGCGGTCGACAAAATCCAGGAACTGAAGGAGCTCACGCGCTGTGGTTGTTCACGTGTCTTCAATGCAGAACACCATCAAGTCTCTGC
GTAGCGAGGCCAACTCGCTGGAGCAGCAGTTCCGTTCGGCTCTGCGCGCCATGCAGCACGAGGACGCGGCCGCCAAAGCTGCAGGCCGCGGAGACAACGT
CAAGCTGCGCGAGATGTTCCTCGACACGCTCTCGACCAAGGAGTCGCTGCGCGAGGAGAACGTCCGTCTGCGCCGCCTCGCCGACGAGTACTACATGAAG
AACCAGGGCCGCCTGCGTCAGCTGCTGGACTCAAACCACAAGGGCCTGGTGCTCTTCACGGCCGCCGTCAACGACGACGAGTGAGTCGTTCGCTTATGAA
ACACGAGCATTCGCGCCTCGTACCTACCTGCACACTGCGCATCAAGCAACAAGTGTTCACCGTTCTGGAGGACACGGCAAGATCGCGCTTTACCTCACCC
ATGATCTGTTGTCGCTAAGCTTTGAGTATTATGGCGACAAATGGCATGGCTGCGCAGCAGCCGCCTCGATTGCCAGAGGCGGCTAGCTGCCTAGATCTCC
ATAAAGTATCATACCCAGATCTATCTAACTTAAATAGACAAACACCCCCCGCTTCAGCGCACCCAACGCCTTCTCCTCTCGAGCTCTCGGCACTTGACCT
TCAAGAAATCGGCCCCAGCAGGATCTGGCCGGGTGCCGGCAGTAATGGCCGGACCTCCTCGCTCCATGCGGCAAATCACGCGGCATGCCCGACGTGGCGG
CGCATGCAGAGCGGACCGACGTTGACTCTGCCTGCTGGGCCAGCAGTGCTGGCAATCCGGCGGGGTTGGTGTCATCTCCTCCGAGCGCATGGCGCTCTTC
CTGCATCAAAGATGAAGTCTCGACACTCGACGCCTTTTGCTGCTTGGACAGCGACATGTGCCAGTGATACGCATGCACGTTGCGCGCAACCACTTTTGCT
GCGTGATCGACCCCCCGAAGCGGGGGGCGCTGACTGGTCCACAACGCGCGCGTGAGCCAGTGCTGCGGTCTCCCCTCCGCGCGTGCCTGCCTCACTAGCG
AATCCGCCTCGGATCTGAGACCATGGCCCCGACCAAGCCGAACCTGGAGGACCCGGAGGTCAAGAAGCAGGCGCTGGCCTCGCTGGCCAAGACCATCCCG
GTCGTGCCCTTTAAGGGCGTCGAGTTCTTCGACGTGGGCGGCCTGCTGGCCAACCCGGAGAAGCTGCAGCTGACCTTCGACCTGTTCGTGCAGGCCGTGA
CGCCCTTCATGGACCAGGTGGACGCCATCGGCTGCTTCGACGCGCGCGGCTTCCTGTTCGCGCCCTACCTGGGCGCGCTCTTCCAGAAGCGCGTCTTCAT
GCTGCGCAAGCCCGACAAGATGCCGAGCGTGAGCGACACGATCGAGTATTTCAAGGAGTACAAGGGCGACAACAGCGAGGGCGGCGACCACCTGAGCATC
CAGGCGTACGCCGTCAACAAGGGCGACCGCGTGCTGCTCGTGGACGACCTACTGGCCACGGGCGGCACGTGCGAGGCCGGCATCCGCCTCGTGCAGCAGG
CGGGCGCCTCGGTCACGGCCTGCATCTTCGTGGTCGAGATCGCCGTGCTGGACGGCCGCGGCCGCGCCATCAAGGCCAGCACGGACGAGAAGACCCAGGT
CATCTCGCTGCTCACGGAGAAGGACTTCTAAGCAGGCTGGCCTGCATTTAGTTGTTGTGCTTTCTGCGTCGGTCTCGAGGAGAGGGATATACAAACAATA
TATTAGACGATTGCCATGAAGCTTGTTGCGCCCGAAGGCGAAGGTGATGCATGTCAACCGTGCCATGTGTACTTGATCCTTGTGTACTTGTTCCTAAACT
TTGATCCTTGTTTTTTTTTTTTTATGTTCTTTTTAACATACTACTACTACTAGTAGTAGTACATAAATGGATGTTTGTAAAGCAACCGGATTCCCAAGGT
TATCCATATATACAATAACCATAAAGTCTTCACCATATCATACAATAATCAAGTTTACATCGCAGTGCACAGCAACTTTTGCATTCTTGCATCAAAGCGT
CTTGTTACGACGCTACATTGAAGCTGCGAGAAGGGCAGACAAGATTGGCATTCCGCGTTCCGCACCGCACGACTTGCAGTGGCCGACGTCAACACCACTT
TCGCTCTATCGCCATGCTGCGCCTGACCTCCCTCCACGCCTCCAGAGCCGCGCGCCTGCCGCTCCCGCGGGCGCTGAGCGCGCGCTTCGCTTCTTCGCAC
CACAAGGTCTTCCCGGACGCCGACTCGGCGGTGCGGGACATCCCGTCGCGTGCCAAGCTCGTCGTGGGAGGCTTCGGCCTCTGCGGCATCCCTGAGAGCA
GCATCCAGGCGCTCGTGAAACAGGTTAGGCTAGTGCTAACCTGGAGGGTGTTGCGAGTGTTTAGAGACAATACGTAATCATTTGCATGTTCATCTTGTGT
TGCAGGGAGCCAAAGACTTGACCTGCGTATCCAACAACGCCGGCGTGGACGACTTCGGGCTCGGGCTGCTGTTGCAAACGCGCCAGGTTAAGCGAATGAT
CTCGTCCTACGTGGGGGAGAACGCGCTCTTTGAGAAACTTTACCTAACCGGCGAGTTAGAGGTGGAACTCACCCCCCAGGGCACCCTTGCCGAGCGTATC
CGCGCCGGAGGCTCTGGCATCCCCGCCTTCTTCACGCCAACGGCGTACGGCACTATCATCCAGGAGGGCGGATTCGCCATCAAGCTCAAGGCCGACGGCT
CCGTGGACATCCCCAGCGCCCCGCGGGAGGTTCGCCAGTTCGAAGGGCGCAACTATGTCATGGAGGAGGGCATCACGGGGGATTTCGCCCTCGTGAGGGC
CTGGAAGGGCGACACGGACGGCAACTTGGTGTTTAAGGGAACCGCGCGCAACTTCAACGTGGACGCGGCCAAGGCCGGCAAGATTACGATCGCCGAAGTG
GAGGAACTGGTGCAACCGGGAGAGATCCACCCAGGTAAGTTGAAGTCGGTCACGTGAATTGGTGTTGCTTTTTAGGATAGTGTTAACACTGTTCATGCGG
TTATGTGTTGCCAGATGAGGTGCACCTGCCTGGTGTCTACGTGCAACGCGTGTTCAAGGCCACCAGCTCCGAGAAACGTATCGAAAAGCTCACCCTCGCC
AATGCAAAGGTTCGTGGCAACACCAAATAGGCTTCAATTGTAGGATCAAGTTGCTTATGTGTTGTTGCTGCTGTTGCTG