Description :
From Genome Similarity Track
Location :
Scaffold_4:2044475- 2055560
Transcript NameFunction/comments
Phyin_T30-4PITG_03520Putative uncharacterized protein
Phyin_T30-4PITG_03521Putative uncharacterized protein
Phyin_T30-4PITG_03522GPI-anchor transamidase%2C putative
Phyin_T30-4PITG_03523General transcription factor IIH subunit%2C putative
Phyin_T30-4PITG_03524Putative uncharacterized protein
Phyin_T30-4PITG_03525Cleavage induced serine protease family S33%2C putative

Sequence
11085 bases(100 bases per row)
AGCCTCTCCACTCACTTGGTACTCCATCATCTCCATAAACGCTTCTCGGGAGGTTTTCTCCAGCTCCTCATCGGGCGGGTACTTGACGTTCTTCATAAAC
TGGATGCTATCGGTGGACGGCTAGTAGCAACAACAATAAAACGCATAGCATTGTCAGTATTTGTGCCATCACCCATTGATTGCTGCTCAGCACGCACCGG
CATGGCCTGTTGAATTTTCTCGGCGAAACGCTGGCGCTTGCGGTTCTCACTCAGCAAAAACTCCTTCTGGCGACGTAGACACTTGGTGAGCTCCATGACT
TCTACGTATTTTTCAATCTTGCTGGAGCGCTCCAGTGGCAGGTTGGCCTTGTCCTGATTGGCACGGGCTGCAATGCGACTGGCCAGCACATTCTCTAAGC
GCACGATCTCCGACCGCATTTGCTCATTGTCTGCCTGCGAATGTCAAAGGAGAAGGCATTTAATATGGGCATAGGACGCATCGATTGCACTTGGAAACGT
ACACCGGACGAGCTTTTAGCGTACGGGCGCGTGGCCAGGCTGTTACCACCGTTACCGGCGCCGTCATACTGGTCGTCACTGCCGTTGCTTCCTAGCAACG
TGAGGGCGTACTGGTCGTTGCCGAGATCCAGCGCCATCGTCCTGTAGTTGGTGATAAGTGGAAGGCGGGGAACGCGAGCCTAGTCAGGCCGATGCTGCTG
TTTCCTCTCCCCGTCGACTGATCCCATAAAACTCAAAGCCGCAGAGAGCAAATAGCCTTGGATATCGTATTAAATTTAGCGATCTTTAAAATTATCGTTT
TATAGACCACAGAAGAAAACAATCAATAAGCCTTTGAAAACCAATATAAAACAACCGATCAACATTGCGTTTTTAAGACTGACTTTGTTATGTATCGAAC
ATAAGGAAGGTGGACCACGCTAAATAGAAATTGATGTCTTTACATAACGCTACGTAGCCTACACGACACTTCAGCTGCCAGATTGTCCATCTCCCTCGCC
GCCCCGTCTGTGCCAATTCGAAGCTCCTCAGCGGACGCGCTCTCACGTCACTCGCCAAGTTGGAGCTCGAGCCAACAAGCCTTGTGCGCAGCCAAAACAT
AAGAAGCCAAGGGCTGTCTTCTGCGTTTCCCTACGTATCACCGCCAGTATTTGACACATGGGTGACGAGAAGAAAAAGACGTCGCGATCACCGCTGGCCG
CCGCAGCTTACGGCGGTGCGTCTGTGCCAGCATTGGCAGCTTCAACGTCGGCTTTAGTGCACCCAAGCTGACTCGGATGGATGGAGACCGACGACTAAAT
TTCTCCGTGTTGCTATACAGGTCCCGTGGACGGCAACAGCTTGGAAAGCGTCACGCCGCTAAGTTTGGAGCCCGAGTGGGACCCGTACGTCCACCGCAAG
TATGGCGTTGGCCTACAGCCGATCGTGGTATGCGTCGGAGATACATGTATCGTGAAAGAAGGGCAGTGTACTCACATCGTAAGTATGGATTTGATACAGG
GAGTGCTGCGCAACGACCGAACGCCGCTTAATACTCCATATACACCACAGCTCATGAAACTGCATTTAAAGCGCCATGAGGCGTATGATGAACGCCACGA
GTACAATGAGCGGCCTGGCAAGCAGCTTGTGACTACGGTCAAGTCCAAGATTGTACTGGTCATGCAGCCTGTGCACAAAATACGGTGCGTACGTCGTAGT
TACGCTGTCTTTTCAGTGGTTTTCTTACGAACTCGAGGTGCAATCCTGAGCAGGGCTGCTGTGGAGCGCATTGTGGCGATGGTTGTGCCGAGATTTGTCC
AAGAAACGACGTTGTTTGTCAAGGTTTGTCTCAACACTTCAACTGTAGGGACAATGCTTTTACGACTTGCGGTCATCTGATAGTTTTAAATGTTTTCGTG
TGTAGCTACGCCCATTGATCGTCTGGCACTTCACTTCCGTGGTGTGTGTGCCGTTCGTTATTATGCTGAGCCCGATGCTTATCGCACTCAGTATTTGCAC
GTCGCCCATTTGGATCTCCGGCGTTGCAGTTCTTTTCGTTCGCCTGTTCATGCGGAGTCAACCTTCTATTGAGGACGAGTTCAGTCCGGATCCCGAGGAG
GGGGAAGAAGAAGAGGAGGAGGAAACGAGTCCGCACCACCCGAATTCCATGTACCGACGCGCGCACCTCACCAACAGCAACGGCCAGCGAGGATACGGCT
AAATTGCCTGCATTTTGCGCTGTCCCAGTTAGTGATTTATTTTTCGTCGTACTCTGAAATTGAAAAGTTCAGGATGAGTAACCACAAAATCATTGCTCAA
ACGCCTAACTTAATGTGTTAGATCGCTTTCGTGGTCACGACCACGGCACCGATCACAGCTGCAGCGACTCCGAAGAAAAAGTCGTTGGTAAACTCAAAGC
TTTGCACGTTTGCGGAAGTCGAGGCCCCACTATGCTGCGCATCTGAGTCAAGCACTCCAACAGAGTCGTCGATCTTTATCGACGCAGAGGTCTTCTCGCT
GAGAGCAGCGGAGTCGATTGGTGTAGCTTCGATCGGATACGCTTCGTCGTCGAAGTGAAGATGCACATCCAGCATTGAACCGAGGAAGTCTGTGATGGGT
ACCTCGTCAATGGAGCGGCCTAAGATGTCAGTTCGGTAGTCAGGTGTCGACAGAAGCATTTTCGGGTCGTAAAAGTTGAAGAGGTCCCGGAGAGTCCCGT
TGCGGATGGAGTCGCCGACCTTCATGCGTTGGAGGTAGTCCAGCGTCGAGAAGGTAAAGCGATCGATGACAGAGAGCCCCAACTGCATCAAAAGAAGCAC
ATCTATAAGTCAGCACCACAGCAACAGCAAAGCGAAATCCAATTACAACAATTGAACCTCAAAGTCGGAGTGGTGGGCGTACGAGTTCTCGCCTGTCTGC
GAGCTGCCGATGGTTACCACTTTGGGGGATTCGAGAGCATTGGACAGCGAGCCTGCCTGACATGTGTCGACCATGAAGAAGATTTCGTTGTAGCTGTGCA
ACATTAAGCACACAGCTTAGCTGGAACAGTTTCTTAGCCATAGCACAAGGAGAACTTGAACCCACCGCTTCTTGACATGCATTTCCTGAATAGAGTCGGC
AAGGTCCTGGCTCGACATCTCTTCAAAGTCCTGGCTCAGCCGAAAACGTCGCAGATGTAAGTATTTTAGCTGCGTTGGTCTGTGTATGCGTTAGTGGCTA
ACGGACGCACCTGGAATTTCAGAAACCCGTCGCCACCGTGTCCGGACATGTAAAGCTGCAAAACACAGGTGCATTCACGTGAGCGAAAGGGACTGCGACA
AGCTCGTACGTAGAGATTCCTACGAAGATGTTGCTGTTCTCGTCCGTGTCCAACTTCTTCGATGCAGGCGTCCCAGGCTCATGGCGGCCTGCAAGATTTA
TATCTTGTTAGCATCCGTTGCATCTGCTAGTGACACTCACTTTACGCACCCGTTAGGACGGTGATAAAGTTGGCGACCGACACCTCCGAACCGCGATAGT
CTACTTCGACGTTCTTACCATAGCTGCGAATGGTAGCGATCACAGATAAGTCAGCAGGTTTAGTTGTCGGAGCCTTCAGTCCAGGAGCAGTTGAAACGAA
CAGGTTGATCTTCTGCGTTCGACTATTGAACACTTGTCCTGGGAAACAGTTGCGAGCATTGCATGGCATTTGGTCCGCCAGCATTAGGATGATCTAGTTG
GAACAAGATTCGTCGCAGCAACGCGAGATGCAACATCGTGTCACCGAGCTGTAGTTTCCTTCTTTATGTACTATAATTCGTTCTCTGACCTGACTGTCCG
GGATACCGAGACGCTTAACAGAGTGATAAAGCGACAGTGCATTGGCCACGTGTCTGTAGTTGCTCCAGAAGCGAGACGTATCAACCTAAGCAACATGCAG
GTGGTGTTTTCTGTCAGCAAAAGTCACGCCGAATCGTGCACGCGCTTTACTTACAATCACCGCCCAATTATTCGTGTGGCGGTGGTAGTGCTCCCCGAAA
ACGCAGCTTAGTAGCAGCAGCAGCGGCACCCAGAACGAGAGCGAGAGCGTCGTCATTCTCCCTCAAATGCAATAATGCCGGTTGCTGTTCAATTATCAAT
TATCAAAGGAAGGCTTTCAAAATGGATATTTTCGTTTTGTCATTTTTGCGATAGACAAGTGAAAAAGTATTTTGTTTACCTATAATAAATTATACTTTTT
ATAAAATGTAAATTATGTATTAATATTTCTTCAGGTAAATTAATTCCTCTTTTATTTTATTTTTTAAATCATACAAATACACAATTTAAAGTATTACATG
TAACTGAAATTTGTGCTGTTGATTATAAATACCGGTACCTAAATGCATCTTTAATTTTTTGTATTGTTTCAGAATCATAAGCAAGATGTCGGAGTCTCTT
GTGGCGCTGGTGCGCGTCAAGAAGCGCGACGGACGCGCCGAATTCTCGCTCAAAGGACTACGCTGGACCGCTGATGCATCTCCCGAGGCCCCCACTAGCC
ACCCGCCCATCGCCGTACCGTGGAGCACTGTTCAGGACCAGCAGGTGTCATCGCTCTCAAGTCCTAAGGCCATGATCCGTCTGCGCCTCGCACACAACTC
GACACTCGTGCTGGAGTTTGTTGCCGAGTCCGGCAGCCTGGAAGAAGCTTTCGAAGTGCGCGAGCAGGCCAAGGATTTTATCGCTCGCCGGCTGCGTGAG
AACGGAGCTAGCGGGACTCGCTCTAATGCTGCAGCACTGTGCAACCCCACGGAGATCAAGCAGCGCGCCGCGTTGCTGGCTGCTAACCCGACACTCAAAC
GACAGCACACAGAGATGGTGAATGATGGTCTCATCTCGGAGGAGGATTTCTGGGCGAGCCGTCGCCACTTGATCGCTGGAGAGGCCAGTAAACGACAAAA
GACGGGCAAAACGTCAGCCATCCTGACGGACCTGGCAGCGGACAATGACGCGGGCGGTAATGTGGTCAAGTACAACTTGAACGCAGAAGTGATTCACCAG
ATTTTCATTCAGTATCCCGCCGTCTACAGGGCTTACCAGGGGCAAGTACCCGACAAGATGACAGAGACGGAGTTCTGGGGAGCATTCTTCAAGTCCAAGT
ACTTCCATCGAGAGAGGAAGGCCGGACACGAAGATATGTTTACCAAGTATGAGGAGAAAGAGAAACAAGAGGCTAAGGGAGTGAGTATCGACCCTCGCGG
GATTGTGGACCCGTTGATTGATCTTACAACGACGGAGGAAGATGCGGCAGTGCACCATGCCAAACGGCACATCACAGAGAAAGAAAACCCGTCCAGTATT
ACCATCGCCAAGTTCAATCGGCATGGAGCTTATGTTCTAGACCCGGCGCATGCTGGGAAACTACAGCAGCAAAAAGCAGGGAAGGGCAATGCACAGCAGA
CGCTGCCTCAGAAAAAGAAAGCAGGTTATCACGACAATTTAGGGGATGCTACGCTTCTGGATGATCTCCAGGATAAAGCTTCACCACCGTACAACCCACT
AACATTGGAAGATGAGTCGCGCTACTTCCAACACGCCGAGAAAGGAACGACTGACAGCAGCACGACGAACAAGCTGCCACTATCTGACGCTGAAAAAGTG
TTCCAGGCGACGTGCAAGGCTCCAATCAAACTGGAAAATGCCTATCCGACTTCTAAGACGTGCTTTAATGTACTGGCCGAAGTAGTAGCGTGCTCGGATT
CGACGAGTGATTCAGCTTCAGCATCGTCGGCTGCGAATTTGGCGAGTGGCGCGTTGGCTGCTGAGTACATTCCGAACGAATTCAAGAAGCAGGTCTACAA
CCAATTCCACGATGTGTGTGAATTACTGCGACATTTCCTCTCGTTTAAAGCTAAGGTGGCCGAAGGTGGCGGCCCAGAAGCGCAGCGAAAACTCGACAAG
ATCGTGGAGAAGATGGGGTCCAAGTACGACGAGCTGGTCAAGCTGCGTGAATCGTTGCCACCTCACGAGAAAAACCTGCTGGCTCCACTGCTCAAACCTT
TCGATGACCAGCTCAATCTGGCCTTTATTTAACTCGATTCTTTCCCTTTACCCATGTTGAGCAAAGAAGCACGTCGTAATGCAATATTTGCATTAGGAAA
TACACGATAGAGTTAATTTTTTTTGTGGTATTTTGTGACGAATCGCGTGACGCGATGGACTCGAGCGCTGCCTCTGTGAATGATGCTGCAGTTATGGAGG
ACCCAAGCGGCTTCTCTGATGAAATAAAGGCATCGCCACTAACTGCAGCATCGGCATTAGTGCCGTTTTCCTTTCGGAGCCCTTTCCATGATGCCCTACG
AGATGCCACCCGTTGGTTCCCAATCGCCGGTACTAGTAAGCGCATTCGCATTGATCAAGCATGGCAGAGCGACGGGCGGGGCGGCACGTCGTTGGGCTTC
GGAGCTTCGGTATACGATGCAGCCATTGCATTATCACTGTATCTAGCATCTCATCCAGATCTAATAAAGGGGGGTCGAGTCATCGAACTGGGATGTGGTC
CAGGACTTGTCGGCGTCGTTGCTGCTCACCTGGAACCAAAGAGTATCGTCATTACTGATGGAGATTCTGCATCGGTTGCACTCACACAGCGCAATATCAA
GGCAAACGATCTTTCGGAAGATGTGTGCACTGCTGAGGAATATCTCTGGGGTGACTTGGAGCATCACCTTGTGAGCAGCAACGCCAAATACGACGTGATT
CTTGGAGCAGATATCGTGGCTTGTCCGTACGCCTCGGCCTTTGAATCACTGATGGTGTCGCTGCAACAAATGGCTGGACCCAAGACACTAATTCTGCTTG
CCTACAAAAAGCGTCAAAACACGGAAGAAAAATTCTTCGAAGCGTTTGAAAAGGTATTTAAAGTCGAACCGATTGACCGATCGGAGCTACACCCGGACTT
CCAGGAAGGAGGCGACATCATGATCTTCAAAGGGCGTCTGAAGAATCAATCGTAGAGACTGGAAACAGTGAATAGCTGAGTAAAGTCTACAAGTATTTGT
CAAAGTTACTGTAGAACTGTACTAAATTACCTCGTGCTATCTTGCTGCTAGTGTTGTACTAGTATTTGTCTTGCCAGGCGGTCGATGAGAATTCGGCTGA
ACTCGTCGGGATTCTCCATGAACATTTGATGGCCTCCGTTCGGCACACGGAAGAGATCAGCAGAGCGGCCCTTCTGCTTGAAGCTGTCCACGATACTCAG
TCCATTGCGGTAGTCCATCCAATCGTATTCACCGTAGATGAACGTAAGCGGCATCTTCACACTTTCGGGAAGCAGCGAGCTCACGAGTGGACGAACCGCA
TGCGCTCCAGGAGCAAGATGCGTGGTCATGACGCGTTCTCCGCTCGGTTTGAGGGCCCAGTTGTGGTACATGTACTCCGCCATCTCGTTCAAGTCGACAC
GACCGTCTCGCATGGCGCTTCCCTCCGACATGAATGAGGTTCGGCGGTGCACCACGTTTTGCACCAGCTTTGGTCCATACGGTCCCACAAATCGAGCGAG
AGACATCGGTGTCACACCGTTCTCCCACGCCGAGAAGACCATGCGTCTCAGCCATGAGCGACTAGCAGCTCGTCCTTCCTCCGTCGTCGGATCCGGAGGT
GGTGGTGGGTGTGGCACACCTGCTGGAGATGCCAACACGAGGTGCTGTAGCATCGAACGAAGTAATAACCTTCGTTAGTGGGTACAAACGAAAATGTGCA
CGAAATATTGACTCTACTTACGTTGACTTGGTCAGGGTGCTTCAATGCGTATGAGGATGCGAAGATAGCCTAGAGCACATAAGATAGTGTCAAGAATTTG
GATTGGCCAAGGCAAGCTTGATAGCACGTCTCACCCCCATTGAGTGGCCGACCAAATCAAAATTTTCAAGCTTGATCTCCTTTTGCCACTTCTCGAATGA
GCCAACGATGAAATCATCGGCACTTTCATACTACAAAGCAAGCAAATGAGTGAAACTCACATTTAGTTGAGTACCCGAATGCTTAAATGATCAATGGGTG
ACCAGATGCCTTACGTCATTGAAATTGAAGTCAGGGCGATCCGACCGGCCGACACCAATCCATTCCACTGCGTACTGTCATTAATAAATATCGCACAAAC
AGAGTTATTTCTCAAACTCAGTTGAAGGCTCAGGCTTCTCTACATACCACATTGAAGTGCTTGGACAATTTCTCTAAGTTCTATTGTGCCACAATTCACT
TCAGCAAATCCAATCATGCAATAATATCATTGTAGCAGTGAGCTTACCATCGCCCACACCGCGTTACCGCCAGCGAACCCGTGGACCAGAACAAGGTTTT
TGGCACTCTCGCGCTTCTTTTCGTCGGAGCAGGGCACCACCACGGTGCCCAACTGTGCGACTTTCTTCATCTCGAATGGCGTCGAGATAGCGCGTGTGAA
AATCTTGCGCTCTGCCTCCTCAAGTTTGGAGTATCTTGCAGGGACCCATTGCCAAAGTCGTCCCTCGGTTGCAACACCTGCGGCAAGCAGTACCGCTTCA
GCATTGACATCTCAGTTACCTAAACATGCAATAATTCAGCTGCTCAGCAAGCGCGTACCTGTTGTGGCGGCGATGGGGCGCAGCATTCGAAGCATTAGAG
GCTGGTGATGCTTAAGGTTAAAACAGTTATGCGGTCCGAGGACGAGTGATGCGCGGGTTGCATGACCTACATTCCCGTGAAAGACAAGTAAACACTTCAG
GATAGCATAACGCATGTGACATGATAGTTTTTGATGGCGGATTACGCGCCACAATGATTATGTGGCACTAACTAAATGGCTCTTGCGAGAGCCGCAAGCA
CAACCTCATTGAAAGCTGGAGCGTTGTCCATGAAGAGCTGGTGACCCGCTCCGGGAACCAGCACGACTTTCACCCCATCTAACGTCTCAGCTACTTTCTT
GCCGTGACTGGAGCTCATCCAATCGGGTCCACCGCCGTAAAGGAAAGTGACGGGGATCTGGATATTCTCGGGTGTCAGCATCTCACACAGCGGTCTCTTC
GCGTAGACCCCTGGTAGTAAATGCGAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTACAGGGAGATTTGGAGATGTGTCCTAAAAAGCGACTAATTC
TTCGCTACAGAATATTACCTCCTCCGGTTGATAATGATTGCAGCAAGGCAATATACCAGGTTAGGAGTTTTTTGTCATAGGCTCAATTGTATCGTCGATG
AGCGACAATGCGTGCTCGATACGCTGTAGCTTGTTTTGGCTGGTTAATGCTGGTTTGATGAACGTTGTTTTGTCGTACGACGCCTTCGCTCACCGCCCGA
CGAACGGGATATCTGGAGATTCCAGAGGTCTCAGCGACGCGACGCACAACCGAACGCGCTACAACAGGAACTTTTGCAAGCTTCTCTCGCACCTCATCGC
GTTTTTATTTTCGCTTTTAACCGCACTTCTTCTTGATCTGGCTGGACCATACACTCCCTACAACACCTTCGGCGACAGCAACGGC