Description :
From Genome Similarity Track
Location :
Scaffold_248:20444- 22936
Transcript NameFunction/comments
Phymu_g7494hypothetical protein PHYSODRAFT_315622

Sequence
2492 bases(100 bases per row)
TCCTTCAGAAGACTCTTGTTCCGGAAAGCGACACGCTTCACAAACTCGGTCTGGGAACTCTTCGGGATCAGAGTTTTTAGTGCGCTGCGTGTACGTTGAA
GCGCAACGGAGACGATCGAATTGGTCAGTGTCGAGTGCGACGACGGGGGCAGGAacggaggaactgctgcactCACACGCTCTTCTCCCAGTTGAAGGGC
TTCCTGTAAAGCTACTGCGACGGTGGAGTTCGCCTCGTGGTGGGTCTTGGAGGTTAAAAGCACCTGGAACGATGCGCGGGCGGCAAatgcagcgtcttgg
cctAGAGCTGAACTTGAGGTCAGTCCGCACTCCGATGCACACCGTCCAACAAGAAGGTCAGCCCGCGGAGAGACTACGTGAGATATGACGTGCTCACACA
CGTCTGTCGTCACGGTTCCAACCACGAActccaccaccgccttcAACTTGGGATGCACCTTGAACACAGCTTCGGACAGTttgtcgttctcctcctgtAG
TGGCGGAAAGTTGAAGGGGGAACCGGCGGATGCTTTTACTCCTGAACTGGCACCGGGGACGGAGTCCTGAAGTACAGCGAACGAGGAAGCAGTCTCGCCA
CTTCGGTCATCCTCAAGCACGACTTGCAACGGCCGAAGCTTGCGGATTGGCGTCACTGGTTGCCCTGCCGCTATCAATCCGGAGCCTATAGAGAGTTTCC
TGCGAGGTGTCGGCTGCGCGCGGGTCTGCAGAAAACCACGCAAATCGTCGAGTTCACTCACGCAGCTCTGGACGAACACTTGGCTGTAGAGAAACGGCAG
CTGGTCTTCTCCAGAAGCTACCTGTTCATCCGCAAGAGCTTCACGAATCTCCACTGAAGGGAGCAAGTCGTTCGACTGGTATTCATTGTCGTGAAAGGAG
CCGCCTTCCAGACGCAAGACGCGAAAGATTCGCTCGATCTGCATCGCGATGTAGAGTCCAGTCTCGCCTAATGAGTTCAAACGCTGTGAACGGTACAGAA
GCTCCAGTAAGACCACTAGCTGCTTGAAGTATGTCGTCCCCATCGATAGTCGGTCGAGCGATAGCATGGAGAGATAGTCGCACAGCCACGGGATGCACTT
GGAGACGGAAGCGTGAAGGATGCTGTattccagcaactgcttgACGTCCAGGCTGGAATCGCGAGCAACTTCTAGCGTGTTGATCCCTTCTCGTTCTACA
GCTTTGAACGCAGCATTGTGGGCCGATAGACCGCGGATGGAGGACGTCACTTGCCACTGAGGGGAGAAACGAAGGTACCCAAGGAATTTGGCCACCACTT
TGAGTCTCAACACGACTTCCGTGAAATCCTTGCGAGCGTCACTAGAGGGGGAGATTGTGTCTCGAATAGCGTAGAACTGCCGCTCCAACTGGTGCTTGAC
CAACTCGGAGAACTCGTAGCTGTCGCAACTGTGcaggaagtggaagaagaagagctggttgTCCGTAAAGTAAGCCTTCATGCGGTCGAGGGTAGCTGTA
AACTTCTTGGTtgcgtcgtcctcgctcgTGGTCTTGACTGGTTGTCGACTTTTACGCGCCGAACTGTTGTTTCCTTTGCCATTGGCCCTGCTCCCATTGG
AACCACCGCTGTGTGGCTGTGGACCTTTGTTCGAAGGCTTTTGGCTCGAGAAACGTCgatgcagcttcagcagtcgATCTGGTTTGTCTTTCATGATCTT
CAACACCAGATCTTTGTCGCTCTCGCCAAAAGGATTCGAACCAACCTggaccagctcctgcacaaAGAACTTAGCGAACCACCACCTGTTCTCCGGCGAT
ACCTCTGCTAGCAGCTCCCGAGCCGCAGCGATGGCTGCTGATGCCACACCAGCATTTTCAATACCCACCAGACTGTGTtgtttctgctggaactcccTCA
GCAAGCTCAAGAATCCGTCTCGAACCTTCTCGCGGTTGGTATACAAGAGAGACTCGGCAGGCGTCCGGTAGTGCAAGCGGGAGTCCGTTTCTTCGTTGAA
TGGGAGGGTAAAATCTCGCACGGCGCTAGCTTTCATCTCGACCGGCAACTGGCAGCCAATGCGGGTGCTTTCAGCCACACGGAGCTCCTCACGTCGACGA
GACTCGTAATCTAATcgctccagcatgtcctgGCAGATTCCCTCCGCATCGCGTAAGCTGTGCTTCACTAGTTCCAGCAGATCTGCGCCCAGATGAGCGA
GCACCGTCTCAATCTCATTAAACACAATTTCAGCAAAGTCGAGGCAGTGAGAGCGCCAACAAAACTCCGACCTCGCCCCACACGGAGATTCCGATGCCTT
TTGACTGGAAGATTCCGACTGAGAACCACTTTGGCTGCAAGATTTACAGTCTGCTCGGTACAGTAAGCTGATgaggacctgcagctccgtgcaCGTGTTC
TTGACAAACCGCTCCTTGATCAAGAATCCGTACAACTTGGCTGCCTGCTTGTTCATCTGAAAGTCAGCCGCATTCGTTCTCTTTTCAGAatt