Description :
From Genome Similarity Track
Location :
Scaffold_285:20443- 23755
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_285-snap-gene-0.20Telomerase reverse transcriptase

Sequence
3312 bases(100 bases per row)
AAGCGCACTGCAGCGAGGCAGAGCATCTGAAACAGATTCACCTACAAAAGAAAACCTCAACGCCACATTTTCATCAGAGTAAAGCCTCACCAAGGGTTCT
AGACGATTTGCATACATGCACATACCTGGATCGTCTCTTTCGAAAGATATGCTGAGTCAAAGTAGAGCGGATGCCATCGCTGTCGGATCGACGAGAGCAC
CTTGTTGACAAAGAAATCCTGGAGAGCCTTGGTTTCATCGAAAGGAATCGATGCCTGGGTCAAGGAGCTAAAGTATTCCACAACACCATGCCAGGATTCA
GTATTCCACAGCAAGACCCATAGTTTACATCACACTTCACATGACCACTTACTTTTCGTAGTTGACGTACACTTGAAGGCAGATGGGGTCGATGAGCATC
CCACACCAACCGAGTCTTCTGTCATCTGGATCTTGGTCAAACCTCGGAATCGCACGAAGTACATTTTTCTCATTTTTCACGGATACCTCAAAATTGACGC
GACTCTTTGCAAAGTTCACAGAGCATCCGTAGTCCGCGTTACCTTCGTGCATGAGCTTTGCAAACGCTTGGGCACGCTTCAGATTCGTACTGACAAACAG
GAAATCGTCAGTGTAGCGCATCAGTTCTTCATGGTGACAAGAACTTCTCGAGTCGTCCACAATAGCAGCTGCATAGAATTTGCCGAGACGCCGCCAGATC
ACTTTCCGCTCAAAGTTCGCGTAGTAAAGGTTGCAGAGCAGAGTTGACAACACTGACCCCTGCGGGATTCCTTGCTTCTGGACAAAATCCTGGTCGTCGA
TTTGTACGATGTTCCCTAGAAGATGCTCCTTCAGCAAACTGAGCAGCTTGACTTTCGGCAGGTAGTCGTAGAGCACACCGTCAATGAAAACAGCATTCCG
CTTTTTGGATTTCGCCACCAGCTCGTCGAAACCTTGCAGGTCACCAGATCGGAATGCGGGGCGCGCTATCTTGAAAACCAGTGACGTTTTCGTCTTTCGT
TTAGATTTGCTGCTGCCTATGTTGACGAGATTGCTCCGCTGGTAGACCCAATGCTTCCGTATCAAGTACTCGTCTTCTAAAACGGTTTTCTTGAGCATTC
GATAGAGCTTGCGAGGACGGATCGTATCGAAGCACCGCTCGATATCCACGGACACGCAGTATAACGCAGGCGGTGCTTGATCTCCTTGAAGGCGCTCTTT
GCAGCTCTTACATGTTGCCATGCCGCTGAACAGTGGTTTGATTCGCTGATAGATCTCGTCCATGCTGCGCACAGTTGAACCAAGAAGCTGCTTTGCTTGA
CGATCTGCTTCGAATAATAACACACGGTGCAGAGGCTCAAGCGCCTTGTTGACCGATCTCTGGTTACGGTCGACTGGAGACGAGAGATTCATCAGCGGGC
GGATGCCACTCACTTTCGGAAGCAAACGAAGTCGTGAGGTCGCTAGTTGCCGGGGCTGCTCTAGTACAGTGACATTGTTGACGGGCTGCAGAACTCCAGC
GCTTAGGTCGTGCACTGCCACATTGCTGCGGATTATAAAAGTGAGCAGTCAGTGATCATATTTTCGAAATAGAGTAGCATCGAAAAATGCGCGTAGCAAT
ACGAACCTGATGACATCCCAGACTTCACGCTGGTAGTAGACGATCTCATTCGACGCTCCTTCGCGCTCCGTGATGTAGAAGAGGTTCCGCAGGAATGGGA
ACGCCAAGCTCTTCAACAGCCAAGTAATGATCGTTTGGAAGAGTTCCTGGCGCTTGAGCAGTTCGTTCGGAGGGCTTTAGATACAGAAACGGCACATTAA
TCTCATGCGGCACAAATTCGTTGATTACAGTCAGTGATAATGTGTGCACGAACCAATTCGATGGATTTCCCTGGGTATTCATCCACTCCACACCTTTCAC
TTGCATCTCGTTACAACACTATTCACAATAAATCATTGTTAGCATTGGCATCATCTCTACAGATGACAAAGCCCTTTTAGGAGGAAGAACAGCGTACCTC
TTTCAGCGACATGACGTCATACTTTCGCGAATTCACAAACCGCTGTAGAAGGCTCTTGACGCACACCCAGTTCTTCGTTGTACTCTGCCCCCAGATCTCT
TTGGGGATAACTTGCGCGACAAACTTCCGAAGCAGTCGAAAAACCACTTTCTTCGGAACGACAAACTCCCCCAACTGGGAAATTTCGTCCCGATGCTCGC
GCAATTTTGTCAGATCACTACTACTTTTTGAGGCACTCCCAGCAATTGGCACCTGATTCGCAGTCATTCGTAGTCGTTTTCTCGACATTGAGCTGGGTGG
TAGCAAGGGTTCAGATACAGCAGCTGACGCACACGATCGCGACTCGATTGCCTGCTCTCGCCGCTTGCGCTTTCGCTCAAACTGCGCGCTGTCGCTGTCT
TCTTGGCTCAAGTACTCGCTCTTGAGCGCATTTACTTCCATCGCGTAAATCTCTTCCAGACTGTTGGGCGCCAATTTGCTGGGCGATCTCGCTGCGATCC
CTTTCAGCTTCTGATTTTCGTGCATGAATTTTCGAAACTTGGGTGGGATTCGAAGCACACTCTTCGTAAAGGCTTCGACATCCAAGTCTCGAAAGCGGGT
TATCAGTTTTTGGATGATCGGAACAAGGTTGATGAGCCGTTTCGGCAAACGCTTGCTTTGGCTTCCTTTCGCGTCGTCCCGATAAAATATCGTCCGAATG
AGCCGCCCCACCACCCCACTGGAGATCTCTGGGCTCTTTGCCGCTTTCACGAGCTCATGGGAGCCAGAGAAGACGCGTTTCTTGCGGAAATGCCGCGCAT
AGAGCACCTGGTTGATTGAGATCACGCCGTCTTTCATCGGGAAGCCCTTTCTAGGCTGCTTGGGGTTGTTGATGGTACTGGATCCTATCAGCAGCTGCTG
CTGTTGTTTGCTTGCATTGCTGCTGACGAATGACTGCATGGATGTTTGGCGCAAGCTCTTGCCTGCCACCTATACAGCAAAGAAAACCCCCCACGTAATT
GAGATCGTCAAAACTTCATGCCAAGGTACTGAGAACTGTCATATCAGCGAGTATCGGTGGTAAGCACCTGGATATAAGAGTGCTTGGACCCCTGTAGTTC
CATGACGATGACGTGGTGCATCAACAAGTGAAGCATCAGATCATCTCCTATCACAGAATGGAGTAATTGCCAAGAAGACGATTTCTTGAGCAGCGCCACC
AGCGTGTTTGGGTAGTAGCACATGATGCGATTCGACGACGAGACGCGGTGACCCGAGAGACCTGGCGCAACTTCACGATACCCAAGCGTCAGGATATTCG
AGTCATCTGGAT