Description :
From Genome Similarity Track
Location :
Scaffold_212:20443- 22194
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_212-fgenesh-gene-0.14Ubiquitin carboxyl-terminal hydrolase

Sequence
1751 bases(100 bases per row)
GTGCATCTTGTCATGTTGTAAACGCTCAGCAAACGTTCAACTTTGAGCCAGACAACACGGTGCGTCTAGTGTCTTGGTTTGTTGAGGAAATACGACGCGA
AGAACTAACATGAGTTGTGCTATTGGTAATCTGTTCTTGCTGCAATAGATTTTGCACGTGAAGCAGGCGCTGCAAGAGAAGGAAGGCATCCAAGTCGACC
AAATCCGGTATGTATCTGCTTCTCTCGCGTGACGAGGCATCGCAATTTGATGCATGTACCGACACTCATGGCGCTTTTTGTTGTTATTATTGTGTAATGT
TTCCAGATTGATCTACAGTGGCAAGCAACTGTGAGTCCTGTGGTGTTTCTGCCATTGTGTTTGTGAGCGTAGGCTATCGGTATGCTGATGTGTATCTCAA
CGTGTTTGTTTGGCATCTAGTGCGGACGACAAGACCCTCCAAGACTACAACGTCGCCGCCGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTCAATTGCGTGGCGGGTGCTAATCATGGCGAAAGAAATAAAAAAAGAAAGTAAAGGAGTGTCGACGGCGCTATTGGTAAAACATAGACGTAGATGACG
ACGAACAAGCCATAAACGAACGAAACCAGAAGCAAACAATGGTTTTTTATGTTGCGCATTGACTACGTATCTCATTATCTCTTCCCAAGTCACGTTGCTG
TTGTCGGTCCTACTCCAGTCGATGCTTCCACGCACACACCAAGCACTCATCGCACTCATTTTTTACTGCGTCGTCGCCACATTATTGTTGTTGCTGTTCT
GGGCATCCAGTTGCTGCTGGATCAGCGGCTCCAGCTGCTTCTTCTCCGCGAGCGTCTTCAGCAATTGCACGACGAACGGGATGTAGTTGTGCTTGCGACG
TCGGTTCTCGAGCGCCCAGTTTGAGCGCTTGTGCGTTTCCTCGGCGATCGTGGCCTGCAGGTGCGCGATCTCCTGCGAGACCTCGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGAGTTGCGCGAGCTTCTCCTGCGCAATGTCTATCCGGTTGCGCACGAGCGCCAGCAGGTTGAAGCGGATNNNNNNNNN
NGACGCCGCGTACTTTTCGATGCGCTTCTGGATCACGGGACACGCGACTTGGAGCCACGCGTCTTGCTGCTGGGTCTGCGGCAACTCGCCCAAGTCAATG
GGGCCAGGGCGAAGTCCATCGAGCTCGTAGACCCTGCCATTCACGGGCACATACGCGATAAAGTGGTAGACATCGTCATCGCCCGTCGCCTTCCGCTCTT
CCATCACGAACGGCTCGGGCCGCGAGAACGAGTNNNNNNNNNNNNNNNNNNNNNNNNNTGCGTGATACGGATCTTCTCACTGTTGGAGATCGCGAGCCCC
TTAAGATCCGATGGGAAGTCGCTCGTGAACGTCTTGAACTCGGACAGCGTCTCGCCCAACGCAATGTCCTTGCAGTTCATCAGGATCGACAGGATCGCCT
GCGTCGCACACGCGTTATTGATCACCTGCTTGGCGAAAAACAAGCCATTCTCTTCGGCGTCGTGCGCGTACTGCACGCGCTGCTGGTCCTCGTCCGCGCC
ATGGGAGGTCTCGTACTTGAACAGAAACACGAGACCGTACACGGGCGACAGCTCCGCAAACTGCTCCGGATCCAGCGAGTAGAGCTCCTCCACCTGCACG
CCCTTGACGCCAATGTCTTCGATCAACGACGTGAATACGCCTACGTGTGGA