Description :
From Genome Similarity Track
Location :
Scaffold_66:204320- 209746
Sequence
5426 bases(100 bases per row)
GTTCAGCTATGTTCACATCGTTCGCATCAACAGGCCCAAACAGTCTTTCGGATCTGATCGCGTCAGGAATCGAACACATCCAGACCGGTCCAATTGGTCG
TGACCTCGACACATCCTTGTTCTGTGTCAGCCGTCACACTACCTTCGACGTCATCACCGTGCTCTGTATCTGCCGCCATAGTCGATTCCGTATCCGCCTG
CGCAGTTAACGCCATGGCATCGCCTTGTTCTGTAACCGCCGCCACAGTCTCCTCATCGGTGCCCCCTTGTTTTGTATCCGTCGGCACGGTCTTCTCCATG
ACGCTCCCTTGTTCTGTATCCGCCGTAACAGTTTCCTCCACGCCGCCCCCTTGATTTGTACCCGCCGCCACCGTGTCATCTACCACTGGGGGGGGGGGGG
TTAAGAGCAGGTATCAACCCTTCTCGCATAGCAAAACGCCACAACGTTTTGTGTCTAGTACATTTAGCGTTAGAAAAAAGCAAGTCATGTTTATAGCGGG
CAACACGCACCAATAAAGTACTCCACTCCAGCCTTGTCCTTACGAAGCCGAACTGTCACGCCTGGTTTTACATAGGTGTGCTCCGAGGCCAGGCCTGTCG
GCGGTCTTGCCTTCCATCCAGCCTTGATCAGAGAGGCCCATAAACGCTTGAACTCCTTTGGTTTAATCCAATCCGTCATTTCTGGACGATTTTACGAAAT
GCGTGGGCGAGAAGATGACGGGATGAAGTTAGAATTTCGAAACCTCTGGTCATTTTATATTGCCTTTTATATTGCAGAGAAACAATACCTGTCTATCCTT
CCCTCTCTGATCCAAAATGATAAGATGCCCCATCCCCACAATACAAACTCCTATATACGCAGAATCGCTGTCGCCATTCGCGTATATAAGCTTGCGCCAT
ACTTCCAACTGTCATATTACATATTCTGTATAATACAGAACACCGGGCTTAAAGGGTTAAACCGTGCTTCTTGGTTACCCGTCGTCCTCGGTGCTTACTG
TCCGCGATCAATCGTTGTTCCAATCGGCTTTTATTCTGCACTGCTACAAACTCGTTGTCGGTAAATTGGAGTATCGTTGCATCGCCCCTATGTCGCTCAG
TTGTTTTTTCGGCGCGCTGCCGTCGTACTGGCACCATCGTCGTCGACGTTGAGCCCTCAGACCCGCGAATTGCAGCTGCATTTCGTCGCTGTTCGTCTCG
CGGCACCGTCGTCGCCGTCATCGTAAACGATCCCCGAGCTTGTGGTACTGCTGTCCGTTACCGTGATTTTTCCTTCCGTTCTGTCGCCGTGGTCTTCGTC
CCACGTTTTCTGGCGTCCGCTGTCTTGATGTTGAGTTACACGTACTCATCGTGCAATTCGACAGCATTGTCTCGTCGTTCCACAGTTTTGGCTCGTGCTC
CACCGTACCGTAGTCGCTCTCTATCTACAAAGCCCCCCCCCTTACTATCCACGCCGCTCAATACGCCGTTTGAACGCGCCGTATTTGGCTCCTGCCGATC
GGTCGTCGTCCACTGCTATCATGTCCGCCTTGATGCCACGCGCCGTATTTGGCTCCTGCCGATCGGTCGTCGTCCACTGCTATCATGTCCGCCTTGATGC
CACCTTTGTCATTGGCACTCGCTATTGTGCGGTCACCGCCGCTTTCACCATTCGTAGCACCTCCTTAGCTCTCCGTTTGACACCAGTTTGTATGGCACCT
TCACCAGGTGTGCTCGCCTCCGTCGTCGCCACCTTCGCGTCCGTCGTCGTGCCCGCCACGGTATCGCGCACCGCGTGACTCATACTCATACCGTCATTAA
TCGTGCCACCGTTCGGCTTTGCGTCTCCGGGTGTTCTGCGTCCCCCGTAGTGAAGCCCGGTGGCACATCCTCGGCTTTTTATCATGTGGTGGCATTACCG
TGTTCTCTGCCTCCACCTGCGTTGTTCCGCGTACCGTCCTGTCGCCTGCGTTACAGCATTCCGATATTTCGTCCTTCGCCGTCGTTCTCGCGCTGTCAAC
ACCATGCTCGTCGTGGGTGCCCGTGATAATGCATCTACGAAAACATTAGTGCTACCGGGTCGGTACAATACTTCGAGTTCGAATTCCTGCAACGTGATCG
CCCATCTGTGTAGTTTACCCGCGAGGTTCGAACTCGTCATGAGCCGTCGTTGTGCAGACTGATCCGTCACAATCGTAAATCATGGATCGTAGAGACTAGC
GGTCTGGGCGTCCGCTCCGCGGACGCTAGGGCATGGTTGGTGGTGTAGAGAGGGCCGACTACCTCCGCTGCGCTGCGGTGGGCTTAGAATTTCTACTCAA
AGCGAAGCAACATATAGTACATGTATACTGTGATCTACGTATATTACTGTACGTTCCAAAACAACACCGCACACAGTATCCTTAGTGCTCACATGTTATG
GTAGATGACCAGGGTTTAACGTGATTTGCAAGAAGAGCACCATCTTACCCGGAAAGGTTCTGTCTATAATCTCGTTTGAGCGCATTGCTCCCAAAATGAC
ACGAATCGGAGGCGCGCGTGGCTGCAAAGCTAATATATGCTGTTCAGAAGACGGGTCAGTATCAATGATGCTACGAAATATGCGTAGATCGGTGAGGAAT
CCCAGTGTAGCTAGAATAAATACGCCTACTCACACATATTACCCATCTGCACGTCATCGCCGTGAGGCAGTCGACACATATCATCGATTGCGTCGGTCAA
ATAGAGCAATGTTAATCAGCTCCGCGCGCGAAGTATCTTTTAGGATAGGTAGTATTTGCCGATGGTCGCCACAAACATCAATATTATGCTTTAAAATTAT
TCTGCTGAGCTGTTTGTGATGTTACTGAAGGAGTATTTCCACTATCTTCCGCATGCATTTATCTTACTTGCATAGCTGACGTACTTTCGGACTTATTTGT
ATAGCTACTGACTGACAGAGTGGCGTAAATCCTTTCCGACTGACATTATACTGGGTCCGATATGTACGACAAAAGGCCTCGTCCAGATCGGACGAAGAGG
CACCACTGCGTGCACATTCTTTTGACCGCTGCAACATACGAAGATATATGGCTGTAGGCAGAGTATCAGATCGCAGTGATGGTTAGACTTGAATTGAATA
ATAGTTCATGTACATTAGATGGAGTACTTTCGCTGCCTACTTATCAGCTCGGCGTGCTATTTGATGTGTCCGTGCATATATCGCGAGGTCGTTAATGAGT
GTAATTGCCACGCGCTCGTGATACTCGACCTATGCATGGGGTCCCTGTTTCCTTATCGGGACGTTTGCGTCGTCGTGCTAGGGTTCTGTGCTTACGCTAA
AGATGTATCAGTCTGTATTATCAAGCGCATCACTAACTGGGCACAGGCCATTCCGCCGCGATACAGGTATGCTGAACGCGCGTCTGTTAGCAGTAGCCAA
CGCAATATGTACGCGCGAGGCGGGCACACCTTATAGTCATCCGCGACTCAGCCGAGCTCTTAGCTCGGTCATTATGGGCAGGGCACTAAAGTACAGTACT
GCGTACAGCCACATCGACTTGCCACGTCCATCTGTACGGTCTGCACTGTCACGCAGTGGTAGTATCTATGTAAACAGCAGCTTATTCGTCGCACGTAGTT
CCCACTCAATACTGTGGTTTAAATTGTGAGCGCCAATTAGTGCAATACACGCTATAAGGGCTGATGGTACAGATAACATGGTTTTGCGTATGCCCACGTG
AGCGAGTGTACGTACCATCTACGGTGACGCGTATGCAGATAGAGACGGCCAACTTGCATAGGTACACAGTACATACCTCGTGCTAGTTATTATATGAAAC
GCGCTACGCTCTATAGGTGCGTCAACACGCTTGGTAGCGCCACAGTCAGCTTACAGTATGTGCAACCCCAAGCCTTGCACCGTTAGCCAGTATACAAAAC
TATGCGGGGTAAGGGGCTATAAGGATGTATATCCAAATTACCTGCTCTTCTGCTGCTTCTTTTGCTCGATGTACTTGGCGTTTCGGGCGGTCAGCTTGCG
AGGGCGGCTTGGTCTCTTTTTCTTCTTGGGGTACCAGTCAGGACCCATCGCCTTCTTGACGTTCGCCAGGCTTTCCTGGCGGCGCTTTTTGGCCGAATCA
GGTGGTGGGGGCTTTTCCTCCCAGAACTTAACCGCTTTTGGGCCGTTCTTGTACGTAATACAGTGCCGCACGCTGCCCCGTCCGCTGATTGTACGGAGCG
CGTAACCGTACTGCAGCTTCCCGCAACCGACGCAACGCGCCCGGGTATTCGTCGTAGACCGCTGCGGGCTCAGCAGAAGCGGGTCAATCTTCGCCTCGCA
TTGCTTGCACATAGGGCTCGCCATTTTGCAAACTGTGAGTATGTTAGCAACATATATTGTTTTAACCAATTACTTGCGTCCAAATATTAGCCAATAGCAC
GGTACTGTAAGAGTGGAATTAATTTTTAAGCAAAATATTAAAAAGTTGATATTTAATATTTTGCTTTAATAGTAATACTGTCAGATATTTAAACAAATAC
ATACTTTACATGCAATAAAAGTGACTAAATTCACTATGTACCGTGCGCGCATGCATCCATCAGGTGCGGTGCACGGGAGCAGATAGCGCAATGACCGTGC
AGCCGCGTGCCTTCATTGCACGGTGGCAGTGGTGAGTGCCAGGTGAAGCAAAAAGATATATATTGGCAAAGTCCCTAGAAAAAGCGCTGGTCGTGAAGCC
TTCTTTAATATTAAAAATACTTTCGTCTCTTCTTAAAAAAAGTGTGTGGAAAATAACATCGCAGAGCTCATACAAAATACTGGTCTGTGAAGCTTATATC
AATAACATCAATACTATTAATATCGTCTTTACTTTGAAAAGTGTGTGGAAAATAACATCCCAGATCTCTTACAAAATACTGGTCTGTGAAGTCTACATTA
ATAATAATAAACATCTCTATTTGAGAAGTGTGTACAGCTCTTAGAAAATAAAGTGGTTACTGTGCCCGATTTGCAGTACATACGACAGGTTTTGCGTAGC
TTAATGTCAATAATCAATCATCTGCGCAGCTCGCCTGGCTGTTTGCAACCAATCGATGCGTTTCGTGCTCGGCAGAAATGTTTTTCTTACGTCCAATCGC
GAGGGAGAGAGGCGGTCTGATCGTGCGACAGATCCAGTCAGTGTCGCAGGTCGGCAAATATTGCCCAATCAGGGCGCGAGTTAATTGTGTGGCGTTTTTG
CTATAATTGTAATTCTGGCATAGTTAGGTCGAGTCAGAAAGATAGGCGCCGTCCATAAGATGGGACGAAACAATATTAGAAAGGGCGAGTGTAGCCATGC
GAAAAGGCAGGTCAAAGCAGGAAGACAGGGAGTGCGACGGACGGATTGACAGACAGACCGACACGCTACAAGGTTAGAAGCGGGGAGACTAGCGGTCTGG
GCGTCCGCTCCGCGGACGCTAGGGCA