Description :
From Genome Similarity Track
Location :
scaffold_876:2043- 10419
Transcript NameFunction/comments
g10514.t1hypothetical protein
g10515.t1 reverse transcriptase

Sequence
8376 bases(100 bases per row)
AGGATCTCGACGAAGATCGTGCCCGAGCCTGGATCAGCAAGGTCAAGTCCGCGTTCCAGCGAGATCAAGCCACCGAAGAGGAGAAATGCCTCACCTTCGC
GGATCTCATGCTTGGTCCGGCGAAGAACTGGTATCGACAGCTGAGTCGGACGACCAAGACCAAATGGGTCGATCTACTTGACGCTTTCCAGACCCAATAC
TGTGGTCTAGGAATGTCAGTGGCATGGCAATACTATCATGCACGCAAACGATCTGAAGAAACCCCGCTCGATTACCTCTACCGTCTGAATGTGGCCGCCT
TGCGAGCCAAACTCAAGATCAAGGATGGAAATCCCAAGGCCCGCCGGGAACACGTCGATCACTTCATCGAGACTTTGGGTGATCCCGAGCTGGCTGATCG
ACTGACCCTGCTTCGACTAACTGACGTCGACGATCTGGAGGAAATTCTTCGCGCTCGAGAGCGAGCGAAGAGCAGACAGCGACGATCTGCGTTCAGATCG
AAGTATCGACAAAAGCCCCCATCGAGCACGCCCACGGCGCCAGCCAGGGCCGTAGTCCGCGCAATCCAGGCCCAAGATCCGAGTTCGGAGTCAGAAGGAG
TGTCCGGATCAGATGGGTCGGACTCTGAAGGAGATCTTCGAAGGATCTACCTGGCCGCGGCGGAAGACCAGTCGATCGGTGCTGGGGGCGGATCCCACCC
GCCATATCAGGCACGGCACGATCTCGCCCGAACACGCAAGATCGAGGCCGGATCCCCGGCCGCCGTACTTCCTCCGATCGCGATCACCAAGATCGAGGTC
GATGCTCGCACTGTTGATCCAGGAAACGCACGGATCTCGATTGTTGGAGGCGATTGGCCTGCGAGAAGTGCGGAAAGAGGGGCGGATCGCTGTCTATGTG
TGTGCTGTGGGTGTGAAAAGGTCCACGAAGCTGGGAAATGCATCATGGAAGAGTTCTACAACCAGATCCGCCAGTGGTATGATCCGACTCGACACGCAGG
GATATTTCCCGAGAAGGTGAAAAAGATGATAACTAGGACGCTCGCTGGGCTGGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATCTATGCATACGT
GAACAAGAAGTCGGCAGATCGAGGTAGGGAGGAGTCTGATCTACGCGGTAATACATGTGAATCGCATCCATACGCCGCAAAGATCGCGAATCTTCCTAAG
ATCGATGAGTTCCGCCGATCTGATGCAGAGGTGGCCTTGGATCTCAAGAATGGAGAATCCCGGGGTTACTGGAAATATCATGCACCAGGGCAGTGGTTCC
GACAAGCCAAGATCACAGGCAAGACCAATCATGAGAAGGCGATCTTGCTCCTGGACACTGGCGCCGAGGTATCTATATTGGATACCACCTTTGCTCGTAA
GGTTGGGTGCCACTTTGACACTAGTCAGAGACAGGAATGTGTGGGAATTGGCGATAACGTGTATACCACAGAAGGGGGAACGAGGATCAAGATCACGCTG
GCGGGATATCTGCTTTATTTTTTCGCCATATGGATCGGCGATCTCTCGGGCCAGGATGCGATCCTGGGCATGGATTTCATGATTCCGGACGGGGTCCCGA
TGGATCTCGCCAAGGGATCGATGTGTCTACCCGACAAAGTCGGGATCCCGCTTAACGGTCGCAAGAGATTGTAAGGTGACAAGGATCGATCACCCTTGAG
GGAGATCTGCAAATACCGGTCAGGAGGCAGCATCAAGGGTGAAGTTGGGTGCTACGGAGACGTTGTGGGTGACTAGAGGAGAACGATGGGTACCCACAGT
GGTGGATGGTCCTGGTCGAACCCGATATCTTGTGATCTCGAATCTGAGTGAGAATATCTTGAGATTAGACCATCGTCTCCATGTCAGAATGATACTGGAT
CGAGTCAAGGTACCTAGATCTCCGGGTTTCGTGTCAGTGGGATCTCACCGCTACATGGAGTGGCAGAATCTAGCACTGGAGGCCACTGTAGAGGCTCGAT
CGGAACCCCCCGAGATCCGGGAAGGGCCCGTCGAGCCGCTGGTGGAACGCCCGATGTACGCTACCTCGAGATCGATTCTTCGCCGGAGTGAACTAGACCG
CGAACCCTCCTCGATATCGAGTCTGGAGGCTCGATCACAGGTGCCATCAGCCGGCGCGGGCAAGATCCGAGTTGCGTTCCTCAATTCAGACGGAGGCGAC
ACATCTAAGTAGCAATCTGGAGTCGATCCACATGGTACCCTCAGTGACGATGCTGGGGGCGGAAGAATACGTGAGAGCATGCCAGATCAGGCCCCGGATC
GAACTTGCGAAGAGAAGATCGAGGCGAAAACGAGCGATCCAAGTTCTCAAACCGGAATCTCGCCCGAATTTTGCGCTGACGGCACCGCAGCAACCGCAGA
AACCTTGATCCCAGCGACGAGGGAGGTCAAGCATGAAGATCCACCAAGAAGAGGTCTCAAATCGACTTCCCCACGGGATATCGAAAACGGTGATCAAGTC
CATTATCACGAGAGTGGCGATCTTTCGGTCGAGGATCTCGCAGACAATCTCGCCTTTGTCCCGGAAATCTCGATCTCGACTACGGAAGAAGTCAGGATCG
AGGATTTACAGGTGGGGGATCCGGGATCGGGTACCCCACAGGAGATCGAAAAACTCCGGCAGATCATCTGGAAGAAGCGACATCTCCTGATCGGCAAAGG
AAATGCGCTGCCACCGACCGCTAGAGGGGTTGGATGCGATATCGATATCGGGAATGCGAAGCCGATCGCACAGCGAGTGCGTAAAGCAGCGCCGCAGTTC
CGTGAGAAAGTGTCAGATCTGATCAAGGGACTCTTAGCTGCCAAGATCATCCGACCTTCAACATCGCCTTGGGCGTCCCCGATCCTGGTGATCATCAAGA
AGAACGGTGTGGATATCAGGTTGTGCATCGATTACAGGCTGGTGAACGGCCTTACGAGGCTGATGATCTATCCAATGCCCTTGATCAACGATCTACTGGA
GGATCTCGACAAGGTTCTATGGTATTGCTCACTGGATATGGCAAGTGGATTCTGGGTTGTGTCGACGACCGATCGAGCTCGCGCGATCTCGGCGTTCATC
ACTCCATTCGGTCTGTTCGAGTGGAATCGTATGCCTTCGGGCTGAACAATACCCCCCAGATCTATCCAAGTTTCATGGATAATGCACAAACGGATTCCTG
AAGATCTCGCGATCTGGTGACTCAGAAGGCTTAGTTGATGTGTTCGAGTCGGGGATCCCGGAAGATCCGGGTCAACCATCGGTGCTGGGACGTAGATCAT
ACATCGACGACATCATGATCACCGCTGGATCATGGGATCAGATGTGCCAAAGGGTGGAAGATCTACTGGAGGCCTGTGATAAGTGGAACCTGTCGATCAG
TGTGGCCAAGAGCTTCTGGGGCATGAGCAAAGTGGAGTATCTCGAGTATCGAGTGTCGATCGAAGGTCTGGAAGCGAATCCAAAGGATCTGAAGTCTTTG
ACGGATCTACCATTTCCCGGATCACTTCGATCCATGCAGTCGTTCTTGGGAAGCTTGAACTACTACAGCCGATTCATCGAAGATTACACGGTCTACGCCT
CGGTTATGTATGAACTACGTGAAGTGGAGTTCGCGGAACTGCAGAAACGGTCCGATTTGCGGAAGATCATGGTCCGGACGGTTCCGATCACGTGTGATCC
TACCCCACCGAAGCCTGAATCCACAGGATCGTCGGGGGGACAAGAGCGGGAGATTGATCAAGTCCCAGATCAAGACTTGGGGGCGCTCGATCCTCGATCT
GACGGGTCAAGTGCGAGATCGGAGCTTGGGGACGCAGATGAAAGGTGGATCAGGGCTCACAAGGCGTTCACGGCCTTAAAGATGACGATCGCGACAACGC
CGATCCTGCGCACGAGATCACCTGTGGTGATCGTGTATACTAGCGACTGGGCGATTTCCGCCGCGCTGATGCAAGAACACGACGAGATATACCACCTGGT
CGCGTTCGCCAGTCCTACGTTGAAGGTGAACGAGTTGAATTACAACGTGGCAGAGAAAGAAGTGCTGGCGTTGCTGCGGATCCTAGATCTCTACTACAAC
CTACTGGTGGGACGTGAGATCAAGATCATGACTAGGCATTCCACGTTCGCCTGGCTATTCAAGTCGGCTGGACTCCAGGGTCGCCTAGGACAGCGGTCTG
CCCTCCTGTCGCTGTAGACACTCGAGATCACGAAGTGTACGAAGGGTGAAGATGTGATACTGGGGGCGATCGCAGCCAGTATCACGCCGAAATCCAAGAT
CGACGAGGCATTAACCGCGATCGCGCCTCGGAAGGAGCCTAAACGTCGGATCCAAGCGCTGACCCCCACTGTGGATCGAGATGAGGAACTATGGGTTGTG
CGTTTTGACGGATCCGCCCGTGTGAAGCGTGGTGGGGGCGCCTTCAGCGCGATCGTGCGGAGTCTGCCCGAGTGGAAGGTGGTCAAGGCTAGATCAGGCT
ATACCGAGAGTCTTACTGTCAATGAAGCCAAATATAACGGCCTATTGCTAGGACTGGGACTGCTGAAGGACCTCGATCGTAGACGCTTGGTGATCTGTGG
TGACTCCAACCTCGTGATCAGGCAAGTTCGCGGCGAGATCGACTGCAAGGCGCCGGGATTGACGTTGTTGAAGCAGAAAGCCCTCGATCACCCGAGAAAG
TGGGGTGGTCACGAACTAGTACATGTGAAGAGAGACTGGAACGGGAGCGCGGATAGCCTGGCGAGTGCGGCTCTGCAACGACAAGACGGGATCGAGGTCC
ACAATGATGCAGATCGCCAGGATCTAGTCACCCTTAATCGGCTAGACGAGATCCTGGTACCCAAGACCGACAATCCAGTGGTACGAGTCTCGGCGGTGGC
TACACGGGCCAACGTTCGAGCGAGATCCAACGCCGCTGTCTTGCAAGAAGAGTTGATCCGAATGATGCGGATCGATCGGATTAAGCGAGCGCAAGATGAA
GAGGTCTGGATCGCGGGAATGAAGAAGTACCTGATCGGGCAGATCGCAGATCTTACCCAGGCTGAATATCGATCCTATGGCAAGATCGCGGCAGATTACG
AGGTAGAAGAGCAGATCCTGCTCGTCAACCTCGTAATAACCAGTCTCATCAACCCATCGCGATCGTCGCTCGATGTCGTCGTAGGAGGACGAGATCGAGC
GACGATCGCGATGGGTTGATGAGACTGGTTGTTCCGGAAACACTCCAGCAAGATGTTCTACACCACTATCCCACAACCTTGGAAGGAGGCCATCAAGGAA
TCGGCCGTACCTACCAGCGAATCCGAGATCACTTCCACTGGTGAGGTTTGTATCGGAGTGTGCAGAGATATGAGGGTGAATGCGTAGATTGCGAGACCAG
CAAAGGAAGACCCACGATCCAGGGTGAATCACCCGGAAATTTGCAAGCCACGTACCCATTCCAGATCATTGCGATGGATCACATCCCGTCCCTGCCCAGA
TCCAACAAAGGTAACATGGAGTTGCTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCAAAGGCTAGCTCGTCTCGATCAGCCCAGACCTTCGCGG
AATCTTACGAAGAATGCGTGTTCCGGCGATTCGGGGCGAGCGAGATGATCCGGCATGATCGAGAGCCAGGGTTCATGTCTGACTTCTTTAGATCGTTCAA
CAAGATTCTGGGACAGAGACAGCGAGCCACGATGGCGTATCGACCTCAAGCCAGTGGAACAGCAGAGAGAATGGTGCAGACGGCGACTAGAGCGCTCAAG
ATGTATGTTCAAGACCTGGATCAGAAGGATTGAGACGAGTATGCTGAACGATTGACGTTCGCGATCAACACTTCCCACGATCGAGTCCGAGGAGATACCC
CTCACTACTTGGTACACGGGTGGGATCCAAGATCCACGTTAGAGGCGACGATCCCAGTTTGATCTACTAGACGGCAGGATCGCGATCCACGCCGGTGGCG
CTATCGGATCCAGCGGTACTATCAACAGTCACGGGAACGAGTCAATGCTAGATTGCGAGATGCGATCTCGGATCGAGCTGATCGACACAACGAGGATGTT
GACCCACACCAGATCGAGGCTGGATCCCAAGTCTGGCTGTATCTCGATCGGGTGAGAGAAGGTTACGCCCGTAAACTAGCCCACCTCTGGCATGGCCCTT
TTCGAGTAGCAGAGAAGATCAACGAATTCACGATCAAGCTCGAGATCACCGGAACGGGATATAAAATATTCCCAGTGGTCCATGTCTCGAAGCTGAAGCT
GGTGAGGATCTTCCCTGATCGACCCCGGATCGAGCTGACGGTAGATGAGTCGGATCGTCTCGACTTCGACGAGATCCTACTCCCTTAGGACAGCTGGGTC
CCGGATCTGGAAGCCGACGAGTACGAAGTTGAACGAATCTCGGATATGCGAAGTGGGAAGAGAACTCGCTGTGGCCGGATCTATCGAGAATTCTTGGTAC
ATTGGGTGGGTTATGAAGAACCGACCTGGATCGACGAGGTAGATCTCAACTGTGGTGCTATACTGAGTGCGTTCCTGCGAGATCACGTGAATCACAACCG
GTTCGGCGTGATGCAGTCGCATGAAGAGATGTAGAAGGGCGATCGGTGAGTCGAGGTGGTCGTCTCACCAAAATCTGAGGAGATGGTCTGGAGGGCGATC
CAGATCAGGAAGAGGACTTTGTTTTTTGTGTATACATGTGAAAACAGGAGTGATCGAGCTTGATGGAGGGAAATTTCGAACGGTTAAGTGGAGATGGAGC
GAGATCACGATACGAGAACAATGGAAAAGGCAAGGAGAGCGTGGATCACAAGCTAGATTTTGAATTACGTGAAAAACGAGTGGAAACTGAACTCGAGCTT
GGGGATAAACTGACGAGAGGCTTCACACAAACGTACTGCAAATGGATAGGCAATACCGGTATTTGCCGACTCGCCGATCCGTTGCCGACTCGCCGATCCG
TTGCCGACTCGCTTGGATCACGCGACATCGACGTAGACCTTGGAGCCGTCCTGCGATATCTTGAGTTGTCATGTGGAATCGTGGATCATGGTAAAGACAA
GAGGTATATGGATCACAAGCAAAAATTTCGGGTTACGTGGAGAAAGAGTGGAAACTGGACTAGAGCTTGGATCACGCGACACTGCGGTGTCGTGAGGTGA
AAGGCGAGGGTCATCGGTTGGGATCTGGGACAATACGACTCAGGCGAAGCTGGATCGTGAACTTAAGGGGCCGAGGGTGCTGCTGGGGGATTGAACTTGT
CCGAGAGCCGCCCGATCCGTCGAGAAGGATGATCTGCTTGGCGATCGCGGTAGTGATTTCGCCAGGGGCCTTCTTCATCGCATTTAGCCAGAGCGGTGAT
CAGATCGGTTGGCTCCGGTCGGTTCAAGGTGAGATTGGCTCGGTTGGCAGCTCGCGAGGCCGATCCCGGATACCAGTGTACCCGATCGTGCGTGGTGGGC
AGGTGAAGGAAGAACGGATCGAGCAAGAGATCGACATCGGCCCACTGACCCCGCATCATCGGGAGAAACGTGGCCAGGAGTTTTCTCCAGCGATCTACCA
CCCGAATTCGTCGCTGACGGCGGGCATGGTGGTATTGATTGAGATCCGCATCGGCAGCCCGCATCGCACTGGTGATGTCGAGGTAGTGGGTCGACTCCCA
GTAGGCTTGAAGATGGTTAGACTCGAGGCCCGCGTAAGACGCGGCGATCTGCCCCAAGGGGGTTCCGGCACGACGATGCAGATCGCGATCGAAGGTGAGG
GGCTCCGGACGGTTCTGCAGCACGAGCCACGGTTGACTTGCCACTAGCGCCAGAACGTTAGCTCCACTGATCAGGTCAGAACGATAACCAGTCCCGGGCT
GCGGAGTCCGAACCGCTCAATCTCGCTCGGGGAACAAGAATCTAGGCGGGATCGGCAACCTCCAAGTCAGTGTGGTGTTGATCATGGCGATGACCGCTAT
AGATCCGACGAAAAGTGGATCCCAGGGGTAAACGTCTGCGGCCATGAACAGTCGGGTGTGGGCGTAACCCGGAATGAACGATGTGAGAGGGAAAAGCGGC
GGGCGTAGAGTCCCACCTGGTGGTGCTCCACCGGGCGGTCCTCTGGCTGGGGCCCCCCGCCAGGCGATCCGCCGCCCTGCCATTCGTGCTGAGATGGAAG
CGGGGTCGCGGGGGAATTCCCCGTCGGTGGTGCGGGCCGTGCTGGGGGCGTCTGCGGAAGAGATCCACCCTGTCCATCTGGAGAAGAGCTGACGGAGACC
CATGCCGGCGGAACCACGAGCGAGATTGCTGTATCATCGTACGAAGTTCATCGTCGGAGCCTGTGTTCGTATCGTC