Description :
From Genome Similarity Track
Location :
Scaffold_249:2042- 5717
Sequence
3675 bases(100 bases per row)
CACCGAGAAGAGTACATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAGGAAATACGAGGCACGGAAACGGATTTCCCCCTCCGATAGTCGGTCGTCT
GAGCACCAGTGGAGAGTCGGGATCGCCTTATAAAATGAGCGATCGCCACTTCACCACGATGATGCGCGTGACCGGATCTTATGGTGACTCGTGATTTCAC
CGTGAGTCCCGGAGTGAAGAGGTGAAAATAAAGCCAGAACCTGGGATGGAAGCGTCAAAGGCAGAGGGATCGCCGCCGATGTGTGATTTTAAAGGATCCC
CAGATTATCGTAGATTTGCGAGGGGCTCTGATGACAAGAAAATCAAAGAGGAAGATCGATCGATCGATTTGGAAGAGAAGCCTCGACCCCTTCCTGAGGT
TCCTTCGGGGACCACCGCAGATCGTGCCGCAAAGCACCATCTGCTGGGTGGAACTCTTCAGATAAAACCGAACAGTTATCACCCAAGACCACTCAAGTAA
AGCCAAAGACGAAGAACTTGAAGACAGTACGAAAGAAGAAAGAAGCGACAAGATCGGATCAGAACGATCGCAGTTTGAAATCGATCAACCGACCGATCAA
GTTCGTGGACGACACAATGAAGATGGAAAGCTGGCAGCTGAATAAGTTGGCGGAGGGATACCACTGGAAGAAACTCAATAACCTTCTATAGAGTGACCCA
GTGCTTCGGATTCTGAAACCCAAGCTGATCGGAGGAATCCAAGGTCCGATACCCCTACCGGCAGTAGCGTCGGATATACTGAAAGAGATCAACGGGATCA
TACGGCTTCTACATGGCGCTGGTTTAGTCGCAGGGGTATTTGACGCGAGCAAAATGATGGAGTGCGATCAAGATCAGGTGACCCACGCGTATCGATCGCT
ATACGACAAGTTAACTCCCCTAACGGGTGAGTGTGATCCTACGGATCAAGCGGAAGCAGCGATCGTAGAACCCCGAGAGGATACCACACCGGATCGTCGC
AGTACGCGTCAGCTAAATCTGAATCGAGTCGGATGATTCGATCGGTATTCAGCGGATGTCTCTAGGCACAAGTGGGGCGGCGCTTCCGCGCGATCTGGGT
TGAAACGATCAAGATTGAACCACGATCGACCACCGCGAGGTGTAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNATCGGGCCCAGACGAAGAAAAGTGTTTGGTGTTCGGGGATCTGTTCATAGGACCAGCACGAAACTGGTACAACCA
ACGGGGTCGATTTACTAGGCACAAGTGGAAGCGATTGCTGGATTGTTTCATGATTCAGTATGGAGGGCAAGGGGTGTATGTGGCTAGGCAATACTATCTC
GCACGGGAGTGATCAGATGAAGCCCCGCTGGAATACCTGCATCTCCTTAATGTTGCATCCAAGCACGCCAAGATCGCGATCAAAGAAAAAAGATTGGCTA
CCTCGGCTTCACATCGCGAACATGTGGAGCACTTCATTGCTACGCTGGACGATTGTGACCTGCAAAACAGCTGACCCTACTGCGATCGATGTATATTGAT
AAGATGAAAGAAAATCTACGTGCGTAATAACGGATGGAGAATCGCCAGATGGAAGCATCGATGGGATCGAACAATTTCATCAGCGAACGACCGCCTCTTC
GACTTCGATGTCGTCGAAGACAGCTCGGGTGGTGCGAGCGATCTGCGAGAAAGACGAAAGCAGCGGAGCAGAATCGGACTCAATTGAATCCAATGAAGAT
ACGGATGTCGTCAAGTTTGCGTGACTACTACACCTGACCAAGAAGAATCTGACAGGGATCATTGCACCTGGCAGAAGAACAATGATGAAGGGATGGACAC
GATCGTGGTGGACGATCGGAGCCATGTACCCATTGTGGATCTACCAGACACGAAGATCGAGGGTGCTGAAAAAGATTGACTTGCCAGAAGTGTGGTCGCA
AAGGACCTCCCTCTGAAAAATGTTTCCTCGTGTGTGCAGCATGCGGAAAGATAGACTAGAGTGGCAAATACCCCATGGAAGAATTTTCAATTTGATCCGA
AAGTGGTACGTGTCCACAAAGCTGATGGAATGTTTCCGCCCAAGGTGGAGGAGATGTTAAACTAGGACGCTCACCAGGTTGGAATCTGCCACAAGCCGAG
CGTTCTAGGCTTTTCATTTACGCGTTTGTTGAAGGACAACGGAAGGATGAAGAGATTAACGATCGAATCGATCCGATCACTGATATACATAATGATTCTA
CATTGGTCTCGTCAATATCAAGTGTGAAAAGAATGGACGATTACACTCGATCGCCTGTGAGAATGGAGCTCGACCTCGCACCAGGGAAATCGCGCGGGTA
TTCGAAATACCATAGTCCCAGAAATGGTTAAAGCAAGCAAAAGCGACGGGAAAGATCAACAACGAGAAAGCCACTATGCTATTCGACTCTGGTCGATCCT
CGATACTACCTTTACTCGTAAGGTAGGATGTGTGATCGACGAAAGTCAAACACAAGAGTGCGTCGGAATTGGAGAAAATTCATATATGAAGGTGGGGCGG
ACGAAGATCAAAATCACATTGGACGGATCGTTGGTGTATTATTTCGACGTTTGGGTCGGTGATTAAGTCGGCCAAGAGGCCATTTGGGTATGGATTTTAT
GGTTCCGGCGGGCATTCGTCTGGATCTAGCCGACGGAACATTATGTCTTGCAGAAGAGGTGCGTATTGGTTTAGCAGGACGAAAGCCACCTTATCGATCA
ACCATGCAGGCGACCAACCAGAATGATCAACGTGTGGTCACCAGTGGGAAAACCGACGGAAGTGCGGATCGGGGCTGGTCAACCCAAGGCCAAACTTTGG
GTGAGGCGAGGCGTGGTGTGGGGGCCGACAGTGACTAATGGGCCTGGACAGATCAAGTATTTACAGCTTACGAACCTCAGCGATCGCGATATAATTCTAG
GTCATGGAGATTCGTTGGCTTTGTGGATGGCATCTAACATGATAGCTCGATCACCGGGATATGCTACGGTTGGATCACGGCGGTATACATAATTGCAAAC
GTTAGCGTTTGAAGCGACTACAGAGCGAGAGGAAGAAGCTGTGGAAGAGTATGCAGGACCGCTGGTGGATCATCC