Description :
From Genome Similarity Track
Location :
Scaffold_37:204153- 218977
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13854ubiquitin-conjugating enzyme E2 35
Phypa_INRA-310PPTG_13855hypothetical protein
Phypa_INRA-310PPTG_13856hypothetical protein
Phypa_INRA-310PPTG_13857tRNA nucleotidyltransferase
Phypa_INRA-310PPTG_13858hypothetical protein
Phypa_INRA-310PPTG_13859vacuolar amino acid transporter
Phypa_INRA-310PPTG_13860hypothetical protein
Phypa_INRA-310PPTG_13861hypothetical protein
Phypa_INRA-310PPTG_13862V-type ATPase, D subunit
Phypa_INRA-310PPTG_13863hypothetical protein

Sequence
14824 bases(100 bases per row)
GCCTCGCTGAGCTGCTGTAGACGATGTCGGAAGGCGTGGATTGCATTCAATCACTTGACGATGTATCTGTTGCGTGTAGGAAACCCAACGGCTGCTAGCG
GAGCCTGGTGCGTACATTACGGTTATATTGAAGTGTATAACAGAGCTGCGTGCTGACTAGTGTGTGTCTGCAGTGGCTGGAATCAGTGCAACGCCGTATG
AAGACAACCTCCGCTACTTCCAGGTGGTGATTGCCGGTCCGCAGTCGTCGCCCTACGAGAGTACGTGGCTGTCTTGTGAGTATGCACGGTATTTGGGACT
TATAGTAGTAATTTTACGCAGACGGTATCTTCAAGCTGGAGCTGTTCCTGCCGGCCGACTACCCCATGGCCCCTCCCAAGGTGCGCTTCCTGACGCGCAT
CTATCACCCCAACATCGACAAGCTGGGCCGCATCTGTCTCGACATCCTCAAGGACAAATGGTCCCCGGCCCTGCAGATCCGCACTGTGTTGCTGAGCATC
CAGGCGTTGCTGTCGGCGCCCAACCCCGATGACCCGCTTGCCAACGACGTCGCGGACCACTGGAAGACGGACGAAGCCGGAGCTGTGCAGATGGGTACGT
TGAGTAAGATAATGCGATGGAAGTTTGGCGAGCTAACTGGTTGTGCTGTATACGTGTTAATGAAGCTGCGGAGTGGACGCGTCGCTATGCTTGAGCTCAC
GAGAAAATAGCAAGAGAGCAGGCGCAGAATCGACTATAGTGTCGCCTTTTCACATTTTTTCTTTCAATTTCTGCATCTTGAAAGCGTTTGTGAAGACTTT
GGTGGTTTTGATGTGTTGTGACGTGGCAGCTATAGCTCCGTGTGCTCCTCGGCTGCAGTGCTTCTAGTATCCTGATCACATGATGCAGTGGACTGCAGCA
CGAAGAGTGGCGAGTGCGACACAGTGAACGGCGCGGTGAAGTCGTCCTGGGAGAAGCCGTAGCTGTCGAGAAGCTGCCAGTCCTGAAGGAGCAAAGGCAG
TCGGAGAGGCCCATATTGACGTTGAGCATTCCATACCAACGTATCAGGTCCAACTGGCACAGCGAGGAACACGGTGACAGACTTCTTTAGATCCCCTTGT
TCGGTGCTACGCTTACAGGAAGGAGCGGCGAGTTTGTGCAGCTCCTGCATGACCTTCAGGTCGCGGTCAGGGTCCAGCGGGTCACCAGCCCGCCCAAGAC
CTTCGCTCGCAATTGACTTGACTGCAAGTATGACGTCAAATCTCTCAGCTGCTGCAATATCATCGATAAACTCAGCCGTGGTGAAAGTCTGCAGTTTTGG
GTGATTGTAGCGTAGTCGATTTCTAGCAACAGTGGTGCAGGATGTTGCTTCTTGAACAAGACACAGACTCTCAATCCATGGACGGCCGTTGCTACCGACG
ATGAGTACGCGCTTGTCTTTTAGCGGATATTTTTCCAGTGCGGAGTACAGGAACGTGTCTGCACTAGAATACCCTGTAACTTTCCTGCGTGCGTCCTCGA
CTAGGGAATCAATTGTTTCGCGTGAAAATTCCTCCCCGTACGAACGCTCCACGCCGCTAGAGACAAACGCAACGAGTTAGCGAAGAACAACATGTACTCA
ACAGTTGGTTGCTATCACAGCCCACTCACGTTTGGTCATCAAAGTACCACTTGCGGACTGGCATCCGACCGTCCATAGTATAGCGACTGCACAGGTCCTG
AGGCATATTCGTTGGTGGGTGTGGCGACACCCGTTCGTCTTCATATTCGTAGATAGTGTCATCCTTCTCACACGACAGGAACCTCGGTTCCGACGGACTG
AGATCGACCCACCGGGCATAGAAAGCTCGTAATTTGGCTCCAGCTTGTTCCACCTTTGTGCCATTTCGATGCGCAGCACTGACTTCCACATACACGCGCA
GCACAAACCGGTCGCTGGCCTTGTTGGGGTCCAGCTCCACTCGGTACTTCGTCGCATATTGTAGATGTGAGTCGATGAACATCTCGAATGCCGCGTCGTC
CAAATTGCTGCTGCTCGGTTCAAAAATCGACATGGTTACGAGCGCTTCATTGGTACTGAAGCCCTCGGGAAGCGACACAGATACGTCCAACACAGTGGAG
GAAACGTGCAGCGCGTCGCTCTCCTGGCCCGCTAAGCTCTGTTCCGTGATCCAAACCTCGTCCTGTGACGGTGCCACGTCGATTTTCACTTGGAAACCGG
GGTCATGCATAGTCCAGCGGTCTCTGCGGAACACGTCGCTACTTGGTAATGCATTGGCGGCGCGCCATGCCGCTAGAGAAGAGAGTACGCAGGCCACGAA
GCGCATTATCAGGTCTGTGATTGACACGCGACCTACCTTGGTAGTCGCACTTATGCAACGTAAGGTTTTTAAGTTGCCACAAGAGCAACTTAGTCAAACA
GTAAATGCATTTTTACCATGGGCATCAGCGCTGCGAATGGCGGCGGTGCTGCGGCGTCGAAGCCGGCGGCCAAGCAGGTGAAGAAGGCCAAAAAGTCCCG
CAAGGCACTGCACATTGCACCTCCGCGCATGAAGTCGCGACGTAAAGCTCGACAAGTGACCACGAACTTCCATCGGTTGACGCATGAGTTGGACCGCCTC
AAGCAGCACAAGTCACTGGACGAGTCGCAGAAGCAGCGCATCGCTGAGATCAACAGGCAGTTAGAGGAATTGGGTGGTCGACAGGCCTACCAGGACGCCA
GTATCCTCAGCACAAGCTTCCACCGCACGTCCAAGTGGGTCTTCCAGCTACTAACTCGCTTCGAGCTGCGACCCAAGGCCAAACAACCTCCGTTGCGAGT
GTTGGAGGTCGGCGCTATCAACACGCAGCTGCTGTCATGTCCCTGGCTGGACGTGCGAGCTATCGACCTCAACTCTAGACACGAACGCATCGAACAGCGC
GACTTCTTCAGCCTCAAACCTGAGGGCGAGTTCCAGGTTGTCGTGTCCAGTATGGTGCTTAACTGTGTTCCTGGTGCCGACAAGCGTGGCGAGATGCTGC
GACTCTATCGGGAACACTTGAAAGAAGGAGGACTGTTGTTCTTGATGCTGCCGCTACTGTGTCTTCGCCACTCGCAGTTCATGACGTACGCACGCTTTGC
CAAGATCTTAGAGGCCGTGGGCTTCCGCGTGCGAGAGACCAAAGACTCGCCCAAAGTCGCTTTCCTCTGCTTGGAGCGGATCGAGACTGTAAATGAGAAC
GCTTCGTTCCCACACAAGCTGCTGGTGTCAGGCGACAAGCGCAATGACTTTAGCGTCGTCATCTAGATAGAAAGGAGTGCAACCTGCATCTGTATATCTA
CTAATCCGACTACCTACATCCAATTGTTTCTATTGCTGTAACGTTACTTCGCCTCAGCAGCAACAACTGCCTTGAAGTGCTCCATGCACTCGTCGCGAGT
TTTCTCGGGGTTGGAGAGTTGCCACGCCATAATACGATCGAGCAGCTCCTTCATATGCGGACCTGGTTTCACGCCAAGTTGCTTCACCAAATCATTTCCC
TGCCAACAGAAATGGTTAGTTGTACACTCATCAAACACAAAGTCACACTTGCAACTTACATTGAGCAGCGGCTTGAGTTCCCATACACCGTCTAAGCCAG
CTTCTCGGACCTGTGAGCTGAAAGTATCGTACCGCTTCGATACCGTGTCACGGGCCTCTGCAGCTCCATCTACCGATCCGGCATCCGTGAGTTCTTGCAC
CAGCGCAGCATCACGACAGATTTCCCACTGGGCACCAATACTGCGAATAAGAAGACCCACTTCCACACGGTCAAAGGCATTTACTGTTGCCTCCTGGAGT
TTACCAACGTGAGTCAATACATTGTCCACATCCTTTGCATCACGATTGGGCAGCTTGAGCGAGTCTTGGACGACAAAAGTAGCGATTGATCGACGGCGCT
TATCACGCACACATAGACCACAGAACGGCAGCAAGAGAGAAGCCAAAATACGGACAAGCAGCTCATGCTTCTTCTCCGCTGATAGATTGTCGACGTCCAG
AACCCCATCCGAAGACAAGTGGCGATACATCTCGGACACGTAAGCATAGCAACGATCCCACACGTTTGCATCAAGTTCCTCCACCTCGCCATTCGGACGA
CAAACGGGCGTCTTTTCCAGCAGAGCCGAGGGCAGGAACACGCTCTCGCAGAGGTGCAGGTCGTGTAGCAGGCACAGCGCACGTTCAGGATGCGCAGCAC
TACCCCTGAGCATACCGGAGAGCTCCTTACCCACACGCTCGCGACTCACTTTACGTATGAGCGCCACTCTAACTTCCTCCAGTTGTGCTGCAGCACGCAG
ATCGTCCTCCAATGTGCAGTTAAACCGGGACGCAAAGCGCACGGCACGCAGAACACGTAGCGGATCATCCAGGAATGTAACCCGTGGTTCTAGAGGAGTG
CGCAGACGTCCGTTCCTCAAGTCCTCGATACCTCGGCCAGTGTAGTCCTCGACCTGCTTCGTAGCCAAGTTGTAAAAGAGACTATTGATGGTGAAGTCAC
GGCGCTCGGCGTCCTGCTGAGGCGTACCGATCTCCACGGTCGGAATGCGGTTGTCCTCGGACGCGTAGGTCTCAGCTCGGAGGTTGACAAAGTCTACCCA
GCCCATATTCTCGCCGATTTGCATGGTGGCTGTCTCCAAGTGCTTGCTCTGGTCCGGGTTGGCCTTGATGACACCCACAGCTCGCGCTGTACGGCCTTGC
GCCGTCTCGTACGCGTTCACTAGGTCCGCGAAGGCACGCCCAGTCATACGATCCAGTACGATGTCCACATCGTCGCTGTCTCGACCCAGAAGCTTGTCGC
GTACCCAACCGCCAGCAACGCGGAGCACAGCACCGTCGGCTGCGGGCTGAGCAGCCACGTCCACTAGAAAGGCGAAGAGTTTTTCCTCGGCTGGTGTGAG
CTTCACGGTAGTCTGGAGAGTGTTTTGCATGACTTCACTAGGCTCTTCGACGCGCTGCTTCTTGCCGGAACTGGAAGAAGGCGACGCCAAACGCTTCACC
ATTCTGCGGGGTCAATGGTAAAGCAAGAGTCTTGTATTCGGGTTTATTACGGTAAGTTTGAAAAGATTGATTTTCGACCAGTTAGATTCGACAACGATGG
CGGATGATGGCATCGCGGCGGCGGAGATTGCTAGACAGATTGCGGCGCTGAAGCCACGCGTAGAGGGGTCCAGGGGCGTCATGGGGTATCTGGTCCGTGT
TGCACATGCTGTGGGCTCGCCCGGCTCGTTTAATGAGAGCTAAATTGATTGCGATGCTGCAGGACAAACCCCAAAGCGACAAACGAGCGGATGTGAACAA
GACGTTTCTAGCCAGCACTATCCGAGGGTTCGTTCGTACTGCGGTGCTGATATTTTGTGCCGGAGCTCCATGCTGAGCATTTTTACGATCGATTGTTGCA
GTGTGAACTCCCACAACCGGCGGCAGGAGGAGGACAAGTGCTGGACGCTGCAGCGGATGGAACGCAAGCTGGACGAGGCGAAAGACCGACGAACCGACAG
TCGAAGCCGCAGTCGCAATAGAAGAAGATCAGACGAGAGAAAACGGCAACGCAGGCCCAGCAGAAGTCGGAGTCGTAGTCGAAGTCGCTCGAGACATCGC
AGACGGAGTCGAAGCAGGAGCAGGAGCAGGCACAGCTCCAGACGCAGCCGTAGTCGCGATCGTAGCCCTGTTGCTGAGGTTGAGGAGGATGAACGCAGCT
ATTGGGCTCGAAAAAAGGCCGACAAGACTCGCAAGCTCTGGGAAAACTTACACTCGGAAGGCACCGTGTCTGTAGACAACGCACCCGACTTCAGTTCCGA
AGAATCTGATGACGAAGATGTCAAACCTAAACAAGTGAAGGCACCACCTTCACCTGATTGCAATGAGAAGAAACAAAAGAAGCACAAGAAGCACAAGAAA
CGTGACCGAAAGAGCAACAAGAAGCCGAAGAAACGGCATAGCCGTTCGTGAATTTCTTCATGACATTGACGAGTGTAAGACTCCTCACGACTAAACGGCA
GCACTTGCGAGCTTTAATCTAAGAAGAAGCCCCCTACAAGTCTGCTGCTTGCTCTAGTTCCATGTCGACACCGCCTGGTATGTTGCGAAGATCATGGTGA
AGATACCCAGTGCAATGACGGCGTTGTTTAAGGCACGACCGTCATTCACCAGCTTCGAGTGGAACAGACACGGGTAGATGAAGGCCAGCGGCACAGAGCA
GAAGCCTCCAATAAGCGCCACAAAGTTGTCCAGCTCCTCTTTGCCGAAGTACGCGATAGTAGCAGTAAGGCACACAAGCGCAAATCGGAAGCCATTCTTC
TCCCAGCGCCAATATCCTTTCTGGCTGTGGTGAGGGAACAGATAACCTTCTAAGATCTTCACCACCGGGTACAACATGAGCGGGTACGTGAACACAAGCG
CGAGCGAGTACGTGAGCTGTACAGACATGGTAGCAATACTGTCTTGGGCGCTGGGAAGGTTGAGAGTGACGACGGACTGCGTCTCCTGGCCAAACGCGGC
GTACACAAGTCCAGCAAACACCGAGAAGAGCGTCACGAGGAACAGCATGGTCAAAGAGACGATCCGCGGGAACTTGTGCTTGATATCATCGTCCATAGCG
TCGTAGATTGGGAGTACTAGTCCAATGCCTTCGAAGCAGTAGACAGCTGTGCCCAGCAGCATGGCCCAGCTCGTCGAATTGAAGTTTTCCCACGTCGCAC
TGCCAACTGGCGCGTCATCCAGCGTGTGCACCGTATAAGAGATGATGTAGACGATGCCAAACAGGATAAGCAGATCTGCGAACAGGTTCGTAAGCGCGAA
GTATTCGATGCGACGCACCCACGACAGCGGCGTGTACAACAAGATCTGGAGCATGATGAGCGTCAATGATGACGACGCCGTGGTTCTCTGGATACCGAAG
GCGGCTAAGATGACCTCTCCGATGTTTTTCTCCACGAAGATCAAGTACGAGCAACAGAATCCAATCTGCGAGAGCACGAGCGAGATGTTCACAGCCACGC
GGCCTACTTTACCGAAGGCCTTTTCACCCACAAGACCGTACGACACGTTGGTGCGACCACCGCGGAGCAACACGTTGGAACAGTCCGTCAGACGTAGCAT
ACAGAAGGTAGACAAGATGGCTGAAGCACATAATGCAGCCAACGAGAAGAGCATGCCGCCGTTCTGGAAACCCTTGGGCAGGAACAGGATGCCACTGCCA
ATAAATGACTTGAGGATCGTGAAGACGGTTTTGCCGACGGTGGCACCAGGTTGCTGCTTCTCGGGCCTTCGCTTCCATGCGCGACTCAACAGCGGCGTCG
CAGTCTCCTACAGAGCAAGAAATATTCAGTCAGGCAACTGTTGCAGCACATCTGCTGTGTCATCTGGCCATTGCCGCGTACATCCGTGTCGTCGTCGTCT
GCAAGGCCCAGATTGGCGACGATGAAGTCTCCGTATGCGGATTCTAGGAAGCCTGGCGTGGGTTGGATGGACTCAAGGAACGAGTCCTGCACGTATGATG
GTACGTGTGGACTGTTGCCTCCCAAATTGGTGATCACGTGGTCGCGGCGGAATCCTCCGGGCTGCGCAATGTCCGATGCCTTGCCTGTTTAGTAGCAATA
AAGTACCAATTAGCGCCAAATAGCACCGTTTGCAGCTCGTATCTGCTAAACGTACCGATATCCTCGTGTAATATATCGCTCTGATCCGGCAGTGACTTCG
GACGCGGGGGTCCGTCCTGCGTCTCCTTGAGGATGGCGAAGAAGATGTCCCGCGTCATGTCCGAGCCTTCCTCAGTAATGTCGTGAACATCCGCGGGCAG
CAGCGGCTCTCCGTCGAGGCCGGGGACAGGTGGCTGCTTGTTGTCGTTGGCCATCGTTGGGCTGCTGGACGATCGATCTGCTGGAGGCTCGGCGGAACAA
TGAATGAGCTCCCAAAGGCAACCAACGCACTTGGCTTCGAAGGGTAGGGTATTTTATGCGACATGTTTTTGACAGAGTAATATGTAGCGAAATAAAAACA
AAACATTGCAGTTTAGATAATTGCTAGTGATTTAACCATAAAAGAAGGTTTTCACTTTTTCGCTGGACGAGTATTTTTCATGGTGTCGTCGGCTTGACAA
GCAGCCATCTTCCTGCGGTCGGCATTGGATTGCAACATGGGCCGTAACCACGTTTGGGTAGCTGCTGGCTACACGGTAACTTGTCAGTCAGTGGCCGGCG
TGGACAAATTTGGTAGCCACCTGACAGCTGGAACTCACCTGCGTGGATGAGTGTATGCGAGGGTAAGTCAGTCGCGAAATCTTTTTCAAAAGGAGCTACG
ATTTGGATAAGATCAAGACGCTCGGTCATTTTTAGAGCATGACTCATCGATTTCGGTGAGAGACAACTAAATTAAGTGGCTACCTTCTGTCTACACACAC
GCGATGGCGTCGAGCTTTGACGCGATTTCTGCGGAGACCGGACCGAGTTTGGAGGAGCTGGCGGCTTCCTCAGAGCTACATCACGACCCTGCCAGTTGGG
CAGCGGACGATGATGATGATGCCGAGTCCCGCCTTGGGTCTTCAGCTTGGGAGTCCCAATCCGACCTTCAGGCTGGACTAAACTTGGAGCAGATTCCTGT
CGATGTCAACGAATCGGGACCTGTTGAGGACACCGAAGTCCGAGGAGTCGAGTCGTACACTCCGGATGCAAATGCTGAAGACGATTCGTCTCGAATGCCT
TTCGACCAGCTACCACATCTCGCCCCAGAGGTTCTGCACCCTAAGAAAGTCTATAAGAACAGCAAGCTTAAGAAAAAGCAAGCTGCACTGGAGCCTGCTC
CAGCAATGGTGTTCGATGTCCACCCACTACTCCAATTTGCACAAACTCACTTCAACCTCACCGCTCCACGTGCTTCACCTTTCCACAAACCTGTCGAGTT
TGACCTGAACAAGCGCCTCGAGTGGGAAAACAAACTCATCACAACTCCATTGACGCGTCTTCCGAAAGAGCAGACTGGTATAGCGCTGCAAGCATTCCGT
AATGTTTCTGGGTTTATGGGGAACCGAGCAAGTGGTAAGAACCAGATTGATCACTGCTTCAAGCTTTTACGCAACGTCGTTCCGCGGTCCCCGGCATTGA
AGGACGAAATCTACTGCCAACTATGCAAGCAGCTCACTCGCAATCCCAGCGCGTAGGTTTTACCATGTCTTTATTGTTTTGAGCCGATTGAACTAATATT
GCTCGTGCTTTATTGTCAGAAATGCTGTATTAAACGGATGGTTGCTTCTAAACGCTTGTCTTGTGACTTTCCCACCGTCTCCACCACTGGCTGAATGTCT
CGAGAGGTTTATTAGCGTTCACATTGGAGCAGGTGGCGACTCTGAAGCTAACTCCGAGGTCTCGGCGTACGCACTGGAAGCACTAGCATCTCTAGGATGC
TGTGCCACCAAAGGCGAACGCAAAGAAATTCCAAGTGCATCGGAGCTGAGAGCTCTACAACGACATGCACTCAATGATTTCACTGTGATGCTTGCAGACG
GCTCGACGTTAATAATGCAGGTCAGTGCATGGACGACGAGTCGTGAGCTAGCTGGTTTGGTAGCGCACAAGCTGGGAGTGTGTCGCGTAAAAGCTTTTGC
ACTTTTCGAGACTAATGACGACGAGGAACAACACCTCGTCCCAGAAAATGAACGGGTTATGGATCTCTACGCTGAATGGGAGCGAACGCACATTGATGTG
AGCGAACTAAACCAAAAGAAGAAGGAAAAGAAGAAAGACAAGTTAGAAGAAACGACCAAAGCTCCCGCTGTTGAAGGATACCATCTCACTTATAAGGCAT
ATCTGTGGGTACACGTGGATGATGAAACTGCAGCCGATGTAGGGCTTTACTATCTACAAGCCGTGCACAACGTACTCAGTGGAAGATACGTCTGTGACGT
GGGTGTTGCTGTCGAGCTTGCAGGCTATCAATTGTTCTGCAAACTTGGCAATGACCAGACTCCAACGCTAAGTAAATTCACGTACGTTGTATATTTTTTA
GTTGTTCTGACAGAAAAATTACTCTTATGTTTTTTGTTTGCTTACTAGAAACGATATTGACGAGTACATTCCTGGTCAACTGCTTAGTGCATCGAATCGT
GGTAGCATTGCTGAGCAGGTGTTCGCTAGCTACGAATCCTTCGTGAATAGTTTGTGCGTGCAGTCGACGCAGCAGGCGCGACTGGCGTATTTGCGTCTCT
GCAAACGTCAACCATTTTACGGTTTAACGCTTTTCCACGTGCGAAATTCGCGTCAACTAGCAGTTTTGCCAGCTCGTGTCGTTCTTGCTATCAACGACGT
GGGTGTCAGTATCCTAGGCGCCAGCGACGAAGTTTTAGCACTTTATCCTTACGCGGATATCGCGAACTGGGGTTACAGTGCCAACTCATTCGTCTTCAAC
GTTGTGCGCGGCAGCGAAGAGACCGAATATTCTTTCAGGACCGTGCAGGTAAAACGATCAATGTGCTTTCGGTTAGTGTGGGTGATCTCACGAGTTTGAT
TTGTTTCAAACAACCAGGGCAAGAGTATCAATGACAATGTGGCCGCCTACGTCGACTACATCATATCACTGACCACGTTTGCTAGCGACTGAAAAATATC
TAGCTAGGTATGCACTGTAGTTATCGAGGTTGCACCGTTCATTCTTCAACTTATTGTGCATTGGCACCAAAACACGTACGGACTTCCGGAGCTGATAGTC
TCAGGAGGCTCTTTAAATGGGTCACGGATCAATGAATCAGCGTCTTCAGGTGGCCAACAAGCCTTAAACTTCTTTTTCATCTTTCTCGAGAGAAGAGAAA
CATGTCGTCTTTCTGTAAGACTCTCCCCCGCCAATTCTGGTTTCTTCAGAAATGGTGCAGACTCGATTCCGAAGTTGTTGGGCTCCCCGATTCCAGACAT
ACGCTCGGGTTTGTCTTCAGTGTTGGATTTCAAGAACTTTTTTGAAGAATGTTGTTGCTGTTGTTGTAGTGTCGAGTCTGAGGACGCCCTATTCAGGGCT
GGTTGAATCGGAGTCATACCCCAGAAGCTCACAGAGCGTGATTTTAAGCCGCCCGATCGACGCCTGGACCACTCCATCAACTGAGTTATCTCGCTGTCCA
AAAGAGTAAACTCGAGCCATTTAGCATACTGAAGCCGGCCATCTGATGTAGTCAGCGACAGTAATTTGGTTCGAAAGTGCCGTCGTAGCAGTGGGCTTTT
GGCAGCATCGGAGACCGACTCGCCATTCTCACGTCGACGAGATTCGTGCATTCGATGCCCTTCCGCATCCGCCAACATCCGATTCGTCAGTAGACAGCAT
AGTAAATCTGAAGCATAGAAAATCAACTAGGTTAAACAAAGTCTCTTTTGTATTAAAGAAGGTATAAGGGAGCCTCACCTGCAAGTTGTTCGATGCCTTG
CTGATTAAGGTATTCGCGACTCTGTTGATTAGGGATCTGGAACAATAGATGTGCCTTTTCCTCTGGCCCTCCACGACTCGCAACCGATAAAAACTAGACA
CAGAAACAAAGAATATGACGATGTTAAGACATCCCCGAGCGGGCATTTGCATGACAAGGTAATATACAAGTATACCTGAATCAAGTTGAAATAGGAAATA
TTTCCGTATCCGTCGGGTCTTAGAAAGTTGTAAATTTGTCCATAGATATCCATAGGCCACTGATAGAAGAGAATCAAGATACGAGCGTTAGGTAGGTACT
CAAAAAGGCGACGATAGTACCTCATTTCTGGTTGGGCGTTTACCGTGTTGAATTCCCGAGCCAGTACACTTTCCAGCTCTTCTTGCCTCAGCCCACGAAG
CTTGGAGCGACCACACGTTTTCCTTTGGTAGCGAAGAAAAGTAAACTCGTCTTGAAGTCGCTCCATTTCCAAGCGGCTGAAATGCGTTTGCTTGGCTAGA
ACTGTGAATTCAGCCTTGCGTAATTGAGGCAGTCGTCGAAGGGCTGCTCGCATGTCCTCGACAGATTCGTCCTTGAGACCATACAGTGTGCGTGCTTGTT
GAAGTAGTGTCTGTGGGGCGATTTCAGTAGCGCTTTGACACTGGTCTAATATGATCTTGTAGATGTAGCTCGAGTCCCACTGCTCCGTTTCCTGTGCATA
TAGACCGTTAATTTCTTCCCAGCCGTATAATTCATGCTCACTCCTTACCATGTGGAGCTGAATTTCGTCCACAGCAAGTCTAAAGAAATGTAGTGCAATC
AGGAGATGCAGCATCGTGCCGTCATTTTCCCGAAGCATCGTGTCCCAGACTTCGTAAAGTAACGGCAAAGTCAGTTCTCCAACCCAGAGCGAGACGAACC
ATTTGCAAGACAACAGCGTCGTCACAAGAGGCAGATCAACCTAATGACACAAACCAAACTGTACCTTTAGATACCACCATCACAAATAAGGAATGAGTAG
AGACCCCACCTTGGCTAAAATGGGATAAAATGGCACGAGTTTCCTCACAACCAGCTCATGATACAGTTTGCAGTCCTATCGTTCAAGCGACTGTTAGCTA
AGAGTCTTTGCAACACCCCCACAACAATACCGTACCACTTGAAACCCGTGTAGCTTCGGTGCCCTTGCAAAAAAGTCCTCTGGAAAAACTCTGCCATGGT
AAAGTCATCCCAAAGTCAGTGAAGAGCTCACCACGAGGCTCGTCAATTGCAATTCACACCTCTCAATGACACTGGCGTAGACCCAAAACGTCTCCTCCTC
GTCCCTTTTCTCATTTACATTCCCAAAGAGGAAACACAGGACATCTGCATGGCCCTGGACGTAGCCGACTCGAGGGTTTCTCTGCAAAATAACAATATGA
GGCTCGATCTCTCCTACTATAAATCTACTTTAGCCCGCGTACCACGCTGTATGCCACCAGAATGTTCTTTATATGGGGTATAAACCGCTGCATTACATGC
TGCGGCAGTTCCTCGTCCTCCTGGTACGCCTCCCGTTCGTATTGAGCCAACAGGAAGAGGCGTATGGACGCGCCCGTGCGCGGCAGATCCAGCTCGATCT
GGCGCAGATCGTCCTCAACCTGCGGTGACACGCAGCTTTCACTTCGGCGCAGATACTCCCGGTAGTTGAGTGCACTGCTGTCGCGCAGCTTCCGAGCCCC
AGACGTCGCGAACCAGTCCAAGGGCATGGTAGATTCTTCAACAAGAGATTCCTGAAATCAGATTTGTGTACACGTTAGGGATCACACCAATTAGGGTTTA
CAGAAACTACAGCGCCTTAATATCTTTCGCAGTCTTCTGAAGCAAACTTGAAAGAGAGCGAGCATGTCGTCGGTTCAAGTGGCACCCACGCGCATGTAAG
GCGTCTATAGCCAGTATGACAGGCGGTGGTGTTCTAACTATGTGAGATTTGTGTGCACTGACGCTGGTTACATCGTTGCAGGGCGCTGACGACCTTCAAG
GGCAAGCGTGTCGGCGCCAAGAAGGGTACTCAGAGCGTCGCTCTTTACCTTGTCGCCGTGAAACTAATTCTAACTGCTGTCTGTAGGGTTTGAACTACTG
AAGAAGAAGGCCGATGCCCTGAAGATGCGCTTTCAAGCCATGCTGCGCGAGATCCAGAAGGTATGTGCAGTCTTCAATGGTAATGGCGTCTGTGAATTCA
GTATTTTGATATGAATTTTGGAACGCTGCGAGCAGACCAAGATGTCTATGTCGACAGAGGCATCGGAGGCGTTCTTCTCGCTCACGCAAGCGCAGTACGC
TGCTGGTGACTTCCGTAATAAGGTCATCGAGTCGGTGAGCACGGCAGAGATCCGCACTCAGAACCGCATCGACAATGTGGCTGGGGTCAAGCTGCCCGTA
TTCACGGAAGTGGAAGTGAGTCGCGAGAAGAGCGACAACATCGGTCTGGCCGGCGGAGGTGGCAAGATCCAGAACTGCCGCGAAAAGTTCCGCGTGTTGC
TACGCGCACTGATCAAACTGGCATCGCTGCAGGTGGGCGACGTCGAGCTAAGGAAGAGGAATGGTGTTAGGGGCACTAATGTATTTATTACATGATGGCA
GACCTCTTTCGTGACGCTGGATGAGGCATTGAAAGTGACCAACCGCCGTGTGAACGCGTTGGACAACGTGCGTCTCCTGTACTGAAGATCTTGCTGCTAT
TACGGAGACTTAATTGTGTTTTCATGCGTGCAGGTGACCATTCCTCGTATTGAGAAGACGATCTCGTACATCACGAGAGAGTTGGACGAGCTGGAGCGTG
AGGATTTCGTGCGGTATGTCCCTAGACTGACAAACTATTGCATTAGATGATCTTTGGTGGGATCGCGTAGCTTATAATGACATTTTTGTTTGACATGGCA
ATTGGCAGCATCAAGAAGGTGCAAGCGAACAAGCAAGACCACGAGAAGGCGATCCTGGCCAGAGAAAAGGGTAAATTTTTAATGTTCTTGTTCACAGCAT
TAAAAGCTTGAGAGCTAACGACGTCTTCCTTGTCCTCTATTGTAGAAGCGGCGGAGGCCAAAAAGTCGTCGGGTGCTGCTGTGGACGACGACCCGTTCGC
GGACGTCGTGGCGTCGGACCGCGACATTCTCGCCCAGTACGAGCCGTCTGCGGACGCAGATGTCGTCTTCTAGGCGGGAGGTGAGGAACTAACTGCTATC
TGAAGTAGTGAGGGTCGTTTGCCAGACTGGCAGTGCCAGTTAAGGTGTCTTTGATGCTAAGCTTCCAACTTCAACCAAATTACAAACCTGTCGTTGACTG
CGTTTCACTATGTCCGCTCCCTAGCCCTTTCCTGACCAGTGAACACAGCAATAATGGAGCCCATCGCTAAACGCCTTAAGCAGTCCGCCGAGAGCGCTCT
GCAGACCAAGAAGAAACAAGAGGA