Description :
From Genome Similarity Track
Location :
Scaffold_53:20415- 28232
Transcript NameFunction/comments
Phymu_g2822heme peroxidase
Phymu_g2823conserved hypothetical protein
Phymu_g2824Drug/Metabolite Transporter (DMT) Superfamily
Phymu_g2825fat-free family protein

Sequence
7817 bases(100 bases per row)
ACCCAATCCATTTGACGAATCACGAATCCTCACCTTCCCATACTTTACTCAAGTCATTGGATTTTCCCCAATCACATGCGCTTCTTTGCGTCGCTTCAAG
GCATGTCCGACCCAGTCGACCGATGTCGACCGCTGCACCTCCCCCCTCCTTCGATCTTCATTCGCCAACTTTCCACCTAGAGCTCaagtcttcagcttcc
acacacacaaaatgCTTCGCCGTGCCGCCGTCCGCGCCGCCCAACAGGCGTctgccgcctccgccgctAAGTCGCGCAGTTTCGCCACGTCACAGCTGCG
CAcggccagcaagaagaagcagccgagCGCCATCGTCCTGGCCGCAGCAGGCGTCGCCGCTGTCGGCGGCTTGGCCCTCACTGACCTGGTGAACGCTCGC
GAGAAGCCCGTGGACCTGGACGCtatcaagaaggagatcgtggagatcttcgacGAGGACAATTACATGGGCCCTACGATTGTGCGTCTGGCCTGGCACT
CGAgcggcagctacagcaagcGCGACGGCAGTGGTGGCTCCACCGGAGGTACCATCCGTTTCGACCCGGAGATCAACCACGGCGGCAACGCTGGCCTGCA
CTTGGCtgtgaaggcgctggagaaggttaAGAAGAACCACCCGGAGATCTCGTACGCTGATCTGTACATTCTGGCTGGTGTCACTATGATTGAGGAGATG
GGAGGCCCCGAAATCCCTTTCCGTCTTGGCCGCCCCGATGCCAAGAGCGGCAAGGAGCCCACTCAGACGCCGGATGACCGTCTGCCCAACGCCGACATGG
gcaacaaggagaagacgacgcagcacgtgCGCGACGTCTTCTACCGCATGGGCTTCGACGACCGCGACATTGTTGCGCTCCTGGGAGCTCACGCCATTGG
ACGCTGTTACCCTACGCGTAGCGGATACAGCGGTCCGTGGACGAACGCGGAGTGGACGTTCTCGAACGAGTTCTTCCGTGAGCTAATCGAGAACAAGTGG
ACGGTCAAGAAGTGGAACGGCCCTATGCAGTACGAGGACCCTACGGGTAAGCTCATGATGCTGCCGGCCGATATTGTGCTGATCCAGGACCCCAAGTTTa
agaagtacgtggagctgtacgccaaggacgaggacCTGTGGTTCAAGGACTTCTCTAAGGCTTTTGTCAAGCTTACGGAGAACGGTGTCAAGTTCCCGGA
GACTTCGGGCTGGCGCAAGTTCTTCGGTGGCAACTAAGTGCCTCATTTCGAGGGAAGGAACCTCCTTTTGTGTGTATGAGCGAGACCAGCTTCAAGCATT
TGGTAACGCTACCACACAGCAACGCAGACCAGTATTCTGGACGACCAGGAGGCTGCTCAAGCGTCTAAGTATGTAAACAATACATCGTCATGATGAAACG
GTCCTCTCTAACCTTATTGTTGATCGATGCCAGTGATTTTCAGCAATTGAGGATTTATTTCGGTCTGTGTTGTGCTGGGACAGTCTCCAGTCGGCAAATG
AGCAGAAGCAATTCTCGTCGTGAACGAAGGCGTGATGTATCTCTTCCGTATGAGCATACTTATCCATGGGAAGACGAACGTGGATCTGCAATAGATCGCA
CAGTGGAGGTAAATGCAGAGGCAAAGCGTGTTTATGCGATGCAGGAGCAGTTGGCACCCATGCTTGCACTTGATCGACCGCtggatccagcagcaagtga
gcACATTCAGGACGTGGGGCGTCGTGTTCTGATCCTTCGTGATACTACCAAGAGAGCGCGCAAACAAAATGGAAAGCACAGCCCTCAACAATCTCCGAAG
CGTGTGATCCCAAGTCGATTCCCTGAAATTGCACCGGACttggatgacgaagatgcagGTGAGCCGGATCAAGTAAtaaaagaagaagatcctgtTATGA
CAGACGGACGAATTGTAAGAGAGCTTGGTAACGTTAGCTGGACAAGTTGACGCTGATGCTGTCTCGGTGTTTAGGCAACAATGCTGATGGACCAGGAATG
GGATACGCGAGCATGGAACACAACCAAAATCCAGACCGCAATAGATACCTTGTACGAAGAGATTGAACACTCCAACGACGACTCGCGACGTGAGCTTGCA
ACTACCATGCTTCTCCGTCTGATGGAGACTCATGAAGGTCGGTATGTAGCGCTAGACCTAATATTGTTGTTGTTAACTCAGGTTTTGATCACTACTACAG
ATGCTGTGGACTATGTGGAGACGTCCTTACCGAGCCTGACGAACAAAGCATTCCGGACGCTAACCAAACATACCGACAACACCAAGATCTTTCGTGTAGC
TCGACTTGTAGCAGTGTTAGCAGAGTGGTTTGCGCACGTCCTGTCAAGCGAAAACGCCGTGAGCAAGAGTATCGGTTGCTTACTGCGAGAAGTTGAGCTG
TGCGCACGAATTCTCCAGCACCATTGGCGGGGAGTGCTGTTCGAGCGAGCAGTGAACCAGCGTAACTGTGACCCGATCGTCCGAACTCGTCTACGCTCGA
TGCACATGATCAAATTCGTAGAGCTGCGTCACCAATTCAAAGTGTATCGGGAAGCTGTTGGACCCGAAGGAATTCCAAGTAGCGTCACACAGGCATACAT
CACCATACTGTACCATTTGGCGAAGATACACCAAGGGCCCCACTCTAAGACCCGTAACACTGTGCTGTCGGATCAGAGGCGGATAGTTGGGTCTGGTCTA
CTTGTATGTCTGGCATCTCTCATTACAAGGCACCAGGACAGGGAAGTGATCGAACTGGTGAAAGGAATTGTGTCCAGTGTCATCGAAGGCCACGGGGATG
AACAAATTGTGGAGATTCTTCAGTGCAATATCGTGCAGAGAGTGCAACTGGACTTGATACACACCATGCAGACGTGCAGCGGTAAAAGTTTATCAACTTC
TCTTTCAAGTTCGCTCAATTTACTGCACTCGATCGCCACCAAAGTTTTCCAAGCTACAGAACGGTCAGTAAATCCTCCAGCAAGCCAAAGAGCGCACTCA
CCTGTGAAAGACCAACACCCAGCAGCTCTAGAGGAGAGGAGCTTTATGGtgaggaagctgaagacagcAGCGCACCAATTTCTGCTAACTGCCGCCGTTT
TCGACACGCTTTTCGAGGTTCTCAGTTTTACTCGAGGTGTTGATGACGTACTGCGAACCCAAGTACTGGACATTCTGTGTCTGTTTGCTCGGTCTCTTGG
GTTTTCTCAGTTGCTGGATGCTCTCACTCGAGACGGCGGGCGATGGCTTGAACAAGTTTTGTTGTGCATGAAAGACGACATTTTACCCGTTGTCCAGGCA
GCAGTGACACTGTTTAATGAAGTTACTTGCCGCTCTGATGCCCGATACGGCCTCACAACGGCGGGCGCTGTTCAGATTTTCCTGCGCTGGTGTCGACCGA
ATTTGGAAGCCTGTGAATCACCGATGACGTTCGTAATGGGACTCATAGGCTGTGCGTTGTTGGCAAGACAAACAGATCAGGAGAAACCGGTCACAACATT
GGTAACAGCATTGGCGACGTTCGAGAATCGGCTAGATGCCTTGTACACGCTGTTCCTGGACCTCGCAACGCAAGATGAAGTCACACCGCGTGCTTCCGAG
AGAACAGCGACGTTTTTCTTTTCCGTCAACGCATTGCCCACCCTCGTGGTATTTCTAACTCAAGTTTCTCCGCGTTGTATGGAGTCTCCAGTACAAAACT
CTCGACAGCGTAACATCAGCTGCATTCTGCTTGGTCGGTTCTGCAAGGTTACTCATGTAGTCCGAGCATGTTTCTCCGAAGATATTGTCAATCATCTTGC
GCTATCGCTGCAGTGCAATCACTTGGATAAAATCGAAGGCTTGGTGGCTCGCAGCTCACCCGGTGACCGCTTTGTCCATGAGTTGGGATCTAAAGAGGCC
TGTAGAGCCCTTAGTCGATTAGCTCGATGTCCGAGTAACATGGTGGATGCACGACTTCGGCCATCTCTCACTTCCCCTCAAATCCCGGAATGGCCTCAAG
CGTTGATTTGCGACGTCATGTTCCGGATGCACGTGCTTGAGGACTTGATTTCGCTTATCCGAATTCCAAGTGACGCAGCAGAAAGCATCGAAGTTGACAA
GGTTATGGCTGCAGTGGAACTTGCAGGGTATCTTCGGCCGCTGCCTTATGGCGAAAGTGCTCGCAACAAGTTTTTGAAGTCGCACGGCGATCATCCGCAC
GGGAAATACGCCCAAGAaaagctcttgaagctcgttgaagtggccgcACCAGCAATTTTGCACATTCTCCGTGAAAAAGGTGCTGGTTTTGACCTGGTTA
GCGCGTGCTGTGTGGCTTTAAGTCGATTAGCATGCAGTAATACAGCCTGCAGTCTGCTTCTGAGCCAAGGGTGCCTACAGACAGCACTAATTCACTTACC
AGATATTATGATCgccactggaactggaaaaGCTTCTCCAAAGCGCAAAAGTGTCGAGTTTAATTCATCTGTCGACGACCatgaactgctggacgtaCCC
CCTGCACTGTACACGCTTTTTGGTAAGCTGTGTGCTGTGGCTGATGGGCGAACTGGGATAATGCGTGCACAGGtgcttcctcgtcttctcAAGCGTATGC
AGTTACGCCATCCAAGTTCTCCAACTCTTGATGACGAGTGCAAAAGTGAGATTGCTGTGGTTATTTCCCGTCTGGCGATGGTCAACGCAGTGGAAGGGTG
TACAAGTGAACTCTTTTTGCACTTTAAGgtcctggaactgcttgcgAAGGTCTTGCTACAACATCGAGATCTTGTGTactctccagcatcatcaAGAAAG
AAGGATGGAGTGAACAAGTGGAGGCTTTTGGTCCATGCTGTTAGCGCAATCGCAGCACTAAGCCAAGACGTGCTCGTGTGTGTACCCCGAGTGAAATCCT
TAGGAATAGTCGAGTTGATATTTCCATTTCTCTCTCGACTGCGTCTCGAAGGAAGTCCAAATCCTCACCTTGAGTCCTTGCAGTACGACGCCGTGACCAT
TATCCGGTCTGTTGCATCGTACCCATTTGGCGAGTTCCATACGTACCTGATAAACGCCAAAGGCACAGCTGATCGATTGGCTTCggatgaaaaaaaaaaa
tcggACAACAAGGATGACACACCACTGCCATTGGTGATGGAGCGAGTGAAGCAGATCGCCTTTGACTTCGCGATGGAGTTGAAAAACAAGCCCATGGCAC
TACGAGACAAGAAATCCGTTGGTGAATTAGCTCGGGAGACGATGGCGTTCATCaacgagcaccagcagcaactagAACGACAACAGGAACAACGAAATTC
AAGTGTCGAATTTAAAGGTGAAGACTCCCCAAAACTGACCAACCAACGTCGAAGCCGTGCTTCTTTTCCAGTTCTGCCGAAGTCTCCTCATGGCTGTTTA
GATGATGCATCTGCATCTCGGAAAGCGACTGGAATTGTGTTAAAGTCCCCGCCAAGTCCCCCTCCAACGGTTCTTGTACTCGACGGGGGATCAAAATCGC
CTGTAAGCTTAAACGGAGTGGATATTGCTTCGACAAGACCAATTGGGAACAACAaagctcgatcttcttctgagTCTCCACAACATCACTACGTTTTCAC
AAGACCCAGGTCGAAAACTAAGCAGCGGAATAAGGATCCTGCATACTGCTTGATGCTTGATCCTCTGTTTGACTCGAATTGTGCGATTAAAAAACAACCG
AGGAAGGCACCTGGCGGATCACAAAACGATAAAGATGATGTACTCGAGAGCAGCTACATTTTCTCTCAAGATGTTGATCGCTTCGGCCATTACGTAAATG
TACAGGCTCGTCGTGACAAGAAAGGAGGCAGGTATTTCCCGTCTCTCGGACGGATTGTCACCTCAGATACAGCACTATCACCTCATGCGTACAAGCGAAG
TCTGCCGCCACAGTAAGACGAACACTGGAGGTAAAAACACCCCTCTATTAAATCCAAGCGTGATTCTAGCAAACGACGCAAAGGGGAGCGGGATTCTctt
gcagactgcagtcAAGGCTTACGGTTGATATCCATTGTCCCCCGTTTGGTGCGCCGTGTTGCCGTTCGAGCCATAGTTATTATTCCTGTTGGCCCCAGTG
CGAGCTAAAAGCCGTTGAGAGATGTCACTGCCACTCCCACTGCGAATGATCATGGGGCTTTGACGATACACCACCTTTCCACGGCGCTTGCGCATGAGAt
gcgtcttctgcagtgaAGGCGACGCGTACATAGGGGACTTCTCCACTGACTGAGTGCCACGCTtgcgctcctccttctcggaATGGTACACCAACAACCC
CATCACAAGCACGAAAAGAGCGAATCCGTCATAGATCGTGAAGGCCTGCCCGGCGAACTTGCCAGTGAGCAGAGGAATCATGTACAGCAGGTCCGTGAGG
GGAAGACCCACGGCCGAAGACACCACGAAGAGCACGCTGCTGCCTTCCTTGAAGATGTACAGCATAAGCTGATTGTACATGGTGTTGAACACAATGAAAA
CTAGGAAAACCTCCAGCACGCCCGAATCGCACGGCAAGTCCTTGCCGTTCAGCTCAACTGCGTCCCCGATGAAACACTCGTGAGCCTTCCACACGTACGA
CGGGAAGTCAGCCCAAGGCACTGGTGGATCACTAAACGCCTTGATGCGTACAGTCCAAATCGTCGCGAAGCCGATAATGAGCTGGTAGAAGCTGATCCAA
ATATTGGCGTACCAGATATCCAGGTCCACGTCCTTCAGCCCGATCTCCTTGTAGACATTCGATGCCGCAGCAGGCACCAACGAAATGATGTAGAGCGAAA
TCCACCCCATGCTGGGATCCGGCGTGTTGGCATTGTCCTGGCCCGTTAAGGCAGGGATCAAGTTGACCATTCCGCCGTACAGCACCAGAATGGAGCCCAA
GATGTGGCCACGCTTGAAGCGTGTCTGCAAGAACATGTACGACAATAACATGTTGAGCGGCAGATTCAACTGGTTCAGTACATTGGCCATGTTCCCcctg
tccagcagcaaagtGAGTCTTCCAGTCTACTGCAACGTCAGGACGAAGAGTCTCACCCGATGTGAGGCGTGGGGAACGCGCCCAGCAGGTTGTACAACGT
GTCGAACAGCGCCATAAGCATGTACTTGTAGTGTGGGAACTCGCGCATCTCCGGTGTGATGTCAtctacagcaaaaaaaaGCTTCAATCAGCTACAAAAG
ATATTCAATAAAACTGTTGGACGGTTCTTCCTACCCGTAAAGTAGATCTTGTATCTGTTTCAAACCCACACAACGTTAGTGTCCTACTTCCAGACTACTT
AATTACATATACGTACGCAACTACTGGAGCTGACGAGACGAGGAAAGCGACGGGGAGGATCACGTTCGTGAAGTACCAGAGGAATTCCGTGTAGTCATAC
GTGATTCGTCTACAGTCAAAAAGGCATTAGTACAGTGAACTCCCAAAGTGTTACGAGCTCTTCACGCACGTGTACAGCACGCGGTCAACACAGCGCGCCA
TGATGAGCAGAGAcagcgccaccgccagtTTGGACTCCCATAGCAGCCGCTTCAAGTCCATCCTGCTGTAGCTTGTGCCTCCAGGAGATCAAATTGAAAA
TGAAGTGAGATGTTAGATCGCAAAACATTATTAACCAATCATAAGTAGATACTTGTTCAGCATTCAGCCAATCAGGACAAAGTattttcttcattttccA
AATTCAAGAAAATGGAGGACCACGGCATGAACCGcatgcaggagctgctgagcagCTACTACGGCCTGCAGGACCAGGAGAGCAGGCAGGAGCAGCTGCG
CAACATCGACTCTCCCG