Description :
From Genome Similarity Track
Location :
Scaffold_140:20414- 23278
Transcript NameFunction/comments
Phyci_123233conserved hypothetical protein

Sequence
2864 bases(100 bases per row)
GGCGTCGGGATGCATCCACGCGTGGCGTTATGATGCTGACGCTCCAAGGAAAAAATATACGTCTCAATCACACCACTGTGTAAAACGTTTCTCAGGTCCA
TTCACAACCGGACCCatgcggccgcatttgggctaaatcctggttttcaagcaactggtgtcagctatatgcactcaaaagcatttcaataggataaaat
atgtggtttatcaactcgataaatgcagacatcctagctcgctcatgaaaatgcGTAGAGTACATTACACCGTTGACACCAATCACTCTTGTAGAGGCTG
GTGCGCCCCCCCTATCCTGTGAGCCGTGCGACAACTTGGACGCAACCGTTGAATTTGACTCGTAATCCGGTTGAGAATGGGGTCGACATGTAGCATCGAA
AAGCGAGGGCCATTACCTTGTTGAAGTCACTTTGCAATTTGATTCCTACGGCTCAGTCGTCCAACACCGAAGAACACCAGTGCCAATGCGCCTGACTAAC
GTTGTGTTGGTGAGTGTCATCTCTCTCTTCATGAGAACCAACGCGGTTACGCAGTCTGAAGCGTCGAAGCTGGCTGTACCCTACTGAGAAAGATTTCCCC
GCTAAAAGACTACTAAGAACTGGTAagacggagaaggagaaggaggaggaggaagaCGATGGCGTCCTCTCCGAGGAGAGAGCGATTAAGTTTCCGACCA
GCGCGGAGTTCACCACTTGGGCGAAGAAACTTCCAGGGTCGAAGAAGCTTAAAATGATCTCTTCGGGAAAGCGCAAAACAAGATTTGGTTATGGCAGAAG
AAGACACCGGAAGAGGTCGCTCACTTTTTGGGACTCGGGAACGTCGCAAACCGTAGTCCGTCCCACTCAAACTACAACACTTGGAAGAATTACAAGACCC
TCTACGACTACAAGATCGGTCTTTAGTCGAGCTGAAAGTCGACCTTTCTCCTAGCGATGTAGTATCGTAATACCCCACCAAGGATAGCAAATTCAATACA
ATTTGTGCACTACAAGGACCACGTTGTATTGCACAACAAGCTCCTAGTGTGTAGGTCACGATATGTTTCTTTGCAACATGATATGTTTCACATGACAATG
AAGGACTAGCTGATTACATTTCGCGCTACACCAAGGTATGGATCCTACATTGAGCTCAGCTCACATAACTATTGGTGGCGTTAAATTTGAGAGGCCCCCT
CGTTTCAGCTAGCATTGGAGTCGTTCGGGTAATCCTGGCGTTGGTTCGCTGCCAGCAGTAGGGGTTGTCTTCTTTGTCGGAATCAACTCAGCCCCGTCGA
TCGCTTCTGCTCGCTCCAATTTCACCTGCTCCGTTAACGCCACGCGCTCGAGGTGCTGCTCGAACCGTGCGAGCGACTTTTTCCGCGGTGACAGATTGTA
CTTCTCCTTGCGGAACCGTGCACGCTGCTCCTCGAAAGCTCGTAAGGCCTCGCGCTCTTCTTGCACGCGTCGAAGCTCGTCGCTATCAAGCTGGGTATCT
TGATATTCTTCACGTTTGTGCTGGGTCCACTGCTCATAGAAGTCGTCTAGTAGCGTGTAATACATGGTAAGGTTGGCCAGCTCCCGTTGCTGGAGGTAAG
CACACTCGCGTTCAGTGCGTCGCTTGGTATTGAGCTGTTTACGCCGTCGAAGCTTGTCGAGCTGCGTGGGCAGCACCGTAGCGAGGAATGGCATCTTCTC
TCGACTTTTGCCGTTGGTTGTAAATGGTAAATGACGAGTTGATGCGTCTTCGTGCGGGTCCGAGAGTTGACGCAGGTCGGCGTGACGATGTCTTGAGCGA
GTTTCGTTCTGCATGAATGCACCTTCATACCAAAATTCCCATGTCTCCGTTTTCTCCCCGGTATCACCAGCTCGTTCATTGTTGCTGGCAAAAATACTGT
CGCCATGGAGGCGATAGTAAAAGTCTCCTCGACCATCCATGGCGTCTTCATGCCAAAACCCGACGTGCTTGGAGCGTCCGCCATCAAAGCGAGCTGTACC
ACGTCCATGACGAGCACCTGCATCGAAGAAGCCTTCATATTCATCGCCATGGCGTTCGCGTTGGTGGCCACGCCCATGCGGTTGGCCCTCAACGAAAGGC
CCTTCAACGAATGAGCCGTCCGGAAAGGTTCTTTTGCAAGCAGGGCCATGAAGTACACCATTTACAAACACCCCTTCATCGATCACGCCCGCGGAGCTGA
CGTATCGACCGAGTCCTGATATGACGCCGTTCCGCATTTCACCATCGTAGACAGCGCCGTCTGGAAACGTGATGTGCATACCTTCGCCGCTCTCAACCCC
ATCACGGTAGTCATCTCCGTTTAGCAGTGAGCATTCATATGCGCGGCCCCGAAGTTTGCCGTTGTATTCATAGCGTCGCTGTGGGCGATCAAATGTGCCT
TCGCACGTCGTTCCCTTGCCATACACGAGTTTTCCCTTTCCACAGCGTGTATTACCAGTGAAGTAGCCGTCATACACTCCAACATTGGTATACTCTTGTC
CCTGGCCTTGTTTCCGCCCAAGTCGAAACGCGCCGGAGTACACGCCTCCGATCGATGAAAAATGAAATCGCTCGTCGATTGGGTCCAAGGGAGCATCGTC
TTCTGCTGCAGCCAATGCTGCGGCCGCAGGAACCATTAGCTCGCCTTCACCATGGCGCAGTCGCCGAAGTCTCACCGTTCGCATGTTGATTTCCTTTAAG
AGATCATCAGGATCAATCATTTGACTCGTCGTTTGATCATCCTCGAAGAACGCCCTTGGCTGCGGTCGTGTCTGCACGAGGCACACGTAGTTCCAGTCAT
TCTTGTCTAGTGCCAGTGAAACGAGATCCTGTCCACGCGGACTCGTAAACGTTGCCGCCCAAGT