Description :
From Genome Similarity Track
Location :
Scaffold_164:20413- 22822
Sequence
2409 bases(100 bases per row)
CAGACGTGTTCCCGAATAAGATACCGGCTGAACTCCCTGCTGACCGTGGGGTTCGGCACGAGATTGATCTCGTGCCAGGTTCGAAGTATTGTGTGACACG
ACAGTGGCCGTTACCTCGAGATCAAGTCGAGGCTATTGACGCATACTTCGAAGGACGCCGTAAGGCGGGTCACGTGCATGAGAGTATCTCACCACACTCG
AGTCCAACCTTTTGCGTGAAGAAGGCTACGGGAGGCTGGCGGATAGTGCATGCATTTAACAAACTAAATGATGCCACTATTTCTGCGCAAACGCCTATCT
CCAGGAAGGACATGGTGTTAAACGCCATGTCAGGGAGCTTTATCTTTAGCGCCATCAATCTAACCTATTGCTTTTACCAGATTCTGATGAGAGAGAGCGA
CATACCAGTCACACCAGTTAGCACCTCGAGTGGCATGCTATGGGAATAGCTAGTAATGCCACAAGGGTTGAAGAATGCACCTGCCACTGTTAATCGCATG
GTGCCTCAGGTGCTGAGACCATTACAGAACTTTGCTCCAAGTTACTTCGACGATATATTCGTCCACAGTCGCGCTGAGGGCGACCTCAGCGAGGTCCAGG
TACACCCTTCAGCACTTGAAAAGAGTATTCCAAGTCATGCGAGAGAACAAGCTCTATGCGAATCTCAAGAAGTGTGTCTTCTGTGCACCGGAAATTCCGG
TGATGGGTTGCTATGTGAGTAGATCAGGTGTTCGAGCTGATCCAGAGAAAGTTTTGTCCATCTGTTCTTGGACCACACCCAAGAACCCCACGGAATTACG
TCAGTGGCTTGGCTTGGCTAATTACTTGGATAAGTATACAAAGGACTACGCCGGTTCTATACAGCCTTTATCGTCACTTTTGATGAAAGACGTCACGTGG
TTGTGGCGTCCTGAACATCAAGCAGCCTTCGACGCAGTGAAGAAGAGCCTGGCGTCAGTGCCACTGCTGGTCCTACCGGACGACTCCAAGCCATTTCACG
TCGTATGCGATGCAAGTGATTTCGCGATTTGTTGTGCCCTCATGCAGTTTGATCATGAGGGCCGTGAACGATTCATGAGCTATAACTCACGACAAATGAA
GCCAGCGGGAAAGAACTATCCAGTTCACGACAAGGAGTTGCTAGCGATGCGCTACGCACTCATCAAGTTCCGCGTTCACCTACTCGGTGAACGCACGTTT
GATTTGTACGCTGATCACGCATCGCTGCGCACAGCGATGAAGAGTCCGCACCTGTCCCAGCGAATGGCACGGTGGCTTTCGTTTTTCTCCGAGTATAATT
TCGTCGTGCATTACAAGCTGGGCAAGAACAACATTCTTGCCGATGCTTTGTCGGGACATCCCTATTATGATCCGCGGACGGCGTTGAGTCGTCAGGCGAC
TGATAACGAAGAAGATGATGATCGTTGCACGATGTGTGTGTTGCTGAACTTAACTCGGGTCAGTCCCGAGCTGTGCTTATTCGACGAAATCGTCGCAGCT
TACGCGAATGATCCAGACTACGCCGATATAATCGCTTATCTGCGCGCACCCAGTGACGTTTCACTGGGTGATCTTTCGAGAACCAAGCGTGATCATATTC
TGTGATATAGTTTGGACGGGGACCTACTTCTGTACAGCATCGATCAATTCGATGCTCCTCGTACGGTGATCGCCAACGACATGGATTTGCGCGCTCGAAT
TATTCATGAGTACCATGATGCTCCAACTGGTAGTCATCTCGGTCGCGAAAAGACTTTCGCGGCTGTGTCTCGCGACTTCTTCTGGCCTCACATGTACAAG
TGGGTGCGCAACTCGATTCGTACGTGTAAAATCTGTCAAAGAGTGAAGCCATCTCCATCGTCGCAGGCTCCCCTGCGACCGTTGCAATAGCAACTGAGGC
TTGGCGCTCAGTTTTCATGGATTTTATCTTCGGGCTCGCACCCGATAGTCAAGGCAGAACGGGTATTCTGGTATTCGTGGACAGATTTAGCAAGATGACA
CATCGGGTTCCTGCCATGCTAAGGTCACCGCGGCAGAAACCGCGGTGTATTTCATCGAAGCTGTGTTTCGCAATCATGGATTTCCGGAAAACATTGTTTC
GAATCGCGATCCTCGATTCACATCCGCGTTCTGGACGTCACTGTTCGAGCTTCTCGGTACGAAACTACGTATGAAGACAGCGGCCCATTCGGAAACGGAC
GGGCAAACCGAGCGAGTAAACCGAGTACTCGAAGATGTCCTTCGAAGTTACGCTATGTCCTCCACGAGTTGGAGTGCGTTCCTACCACTTGCTGAGTTTG
CGCTCAACAATGCTGTACACGCGTCAACAGGGTTGACGCCATTTTTGTGAAATCGGCTCGACATCCTCGAGTTCCTACCCTACTCGCCGAGGGGTCGCCC
CACGGCTCC