Description :
From Genome Similarity Track
Location :
Scaffold_126:20410- 21622
Transcript NameFunction/comments
Phyci_188379Hypothetical protein
Phyci_14160Hypothetical protein

Sequence
1212 bases(100 bases per row)
gccatgaggcactggctcaaaataggccacaagagagccgtcatacggatgactgaggcctgtccgtccatgacgcaagccgacttggcagcgtgggtga
cacggaagctcaagctgcgcaccaaacctgctcggaacacgatcagtaacatcatgaagaacgcggcgaccataatgcatgacacgtacggcgaagacaa
ccagcgcaaacctacgcaagtgacctcgcctcagctggagaagcggcttgcaGCATGGATAATGGATCTGGAACACCGCAATATCTGTGTATCTAGGGAG
CTAATTATTATATGAAGACTCGAGAACTACAAGTTCACCTGTGTGACGCCTGGGACCTGGACTTCTCCAACGGCTGGCTGACGGCGTTCATGCGGCGTCA
CAAGCTGCGCCATCGCGCGAGGCTGGATCCGTCGACCTGAACGCCGCTCGAAAAGGATTGCAAGAGACCCAACAGGTAACCGATTTGTTTTCCACCTCAG
GACATTTATAACATGGACGAAACAGGTTTATGCTATGCTATGGCTCCAACACGCTCCATCTGCACCAAGAAGATGCGCGGCGTCAAGAAGAAGAAGACGA
GGATCACGCTCGTCATGACTGGAAATGCTGACGGTAGAGACGCCCTACCTATTCTGTACCTTGGCCATGGCAAGAACCCTCGCCGCTTTAACAAGAAATC
TGCTGAAGACCTCGGCTTCAACTACACGGCCAACACGAAAGCCTGGATGACCCGCGCCATTCGCTGCGGGGCGTCGACCAGCAGATACGTGCGGCGGGTC
GGTATATCTTGCTACTTCTCGATAATGCATCCTCCCACAATGTGGGCGACCTCgcactgacaaatgtgaccgtacagcacctcccgcccaacacgacagc
ctttctacaaccaatggacgcgggtattattgcgtcattcaaggcggcataccagaagaagcaatttcaccgggtctacaacaagctgcgcgagcacgct
accatcaagaatgtcccgtacgcgatcgaccagctccaagctatgctctggagcgacgagatctggcgtgagattatcagcaaggagacgatcaagaact
gtttccgtcataccggaatctgctatctgggccccaacgacaagccaggcaacgaggcgagctccagctacggacacgacgtcaacgtaggcgaggtaat
ttttcgactttc