Description :
From Genome Similarity Track
Location :
scaffold_1308:2041- 4762
Transcript NameFunction/comments
g11279.t1 hypothetical protein PHYSODRAFT_517962

Sequence
2721 bases(100 bases per row)
TAAATTCTCAATCACAGCTCAATTCTCTCCTTCATCGACAAGCCTTCCTCTACAAGTTTACTCTACCTTTACAGGTTATGAGCCCCGCGCAAGCCTCGCC
CGCGAACGACCGCGACTTTCCGCACCTGAATGGCCGGAACTTCATCATCTGGAAGACACGTGTCACCGCTGCCCTCGATGGGAAGAATCTCCTCGGCTTC
GTCACTCAAGTTGACTACACCGGTGACTCCGACGTCGACCTCGGACCGGATGAAGAGCTGAATCCCGCTCTTGCTGAAGACCTCTCGGACACCCTGGACC
GCATGGGTGCTCCCAAGGCTGACACGCTGCCGGACTCCTCATCGAGTGAGTCCTCTGAAGGCAGCTCTGAGGCCACCGCTGAAGACGACAGCGACGTGGA
CATGGGGCAGGAACCACCCCCCGTGATCCAGTCCTTCACTGCGCTCAAACAGCAGAAGTTGGACCGAGCTGAAAAGCAAAAGGCCAAGAGCCAACGGCTT
AGCTCTAGGCGCTTACGCAACATGGAAGCCAAAGCTAGAGCCTTCCTCATCAAGACCATCGACGACCAGCATGTCCTCATGGTCAAGGAAAAAACTACTG
CGTTTGAGATCTTCCAAACGATCTGTAGCAAGTACGAAGGCTCCGCTGTTCATGGTGACCCGTACTACATCCAGTCGTATCTCATGACGCTGAAGTATGA
AGAAGGCAACGACCTCTCTACCTTCATCTACGACTTGGAGAGTGCTATGAAGGCTGCCGCTGACTCAACCAACAGCGTGCTTAGCGACGAGCAGAAGTCG
CTCTACCTGTATCATTCGCTGCCGGCTGAATGGAAGCCCGAACTCGCTGTCTGGAAAGGCAGCCGGAAGTTCATTCCATACGACGATCTCAAGCGCAACA
TTGAGACCAAGGTACAGAACGAACTCGCGCGCAATCGCTACGTTCTTAAGCAAGGAACACCTGAATCACGGGAGACCCGCGCTGAAATGGCCATGCCCGC
CTCAGCACCTGAACACGTGCTAGTTGCGAGCCCCCCACCTGGAGAAGCAGCTGTGGCGACATCGATCCGATGCACGTACTGTAAACGTGACAACCACGAC
ACGGTTGACTGCTATATTCTGCAACGTCACCTCCACAATGACCAGGTCAAAGCAGGAACGGTACTGCCAGCCAACTTTAAGCTGAAACCACCTCAGCACC
AGCACCAGCGCCAACAACGCCAGCATCCATACCAGGGCGATTACTCTGGAAAACGGGGTTCTCAGTCACGCAACTTTAACAAGGGCCAACGGAATGGCAA
TCGCAATGGCAACGGCAATGGAAATGGCAACGGCAATGGCAACGGCAACGGCAATGGCAATGGAAACGGAAATGGACACGGCAACAATAGTGGACGCAAC
AAATTTCATGGCCGTCACAATCATGACGGTGATACCAACAGTGACTATGGCATCATTGCTATTACCACATTAGACCTCAGTCGTGTCACCACTGAAGCCG
TGAGCCTTACTGCCCTCGAATCCGATCTTGATCCGGTGTGGACTGTCGACTCCGGCTGCACTCGCCATGTCACGTCCAACTCGAAGTGGTTTGAAAACCT
TACCCCAACGACTGGCAAGTCTATCACCGTTGGTGGTAACCACCAGATTCCAATCAAAGGAACTGGTGACGTGAAGATGACGGTCGTGGACTCCAAAGGA
CAAGAACGACTCATCATTCTTAACGACGTGCTGTACGCTCCTGCTCTGCAGTTTAACTTGCTCTCGGTTCGTCAAGCGGTCGCCAATGACTTCAAGATCA
CCCCCCCCCAACGCCAAGAAATGCATTCTGTACTTCACTCATCGTGTCAAGCTAGAAGCCAAGACTGGAGACGACACGACCCTCTACCAGTTCCCAGCGA
AGCTAGCGAACACCGAACAAGAAGCCCACATGGCCACCACAGGTACGCTTGACAATGTTATGCTCTGGCACAAACGAATGGGTCATCCTAACTTTCGCGT
TATGCAGGATCTAGCTAAAAAAGACAAAGTCAAAGACATGGGACTATCGAAGTTTAATCCTAGCAAGGACTACTTCTGTGCATCATGCACGTATGCTAAG
TCTCATCGTAATCCATTCAATAAACACCCTGTTGAACGAGCAAAATTTCCACTTGAAAAGGTCCACACCGATATGGGTGGACCACTACCTGCTTCTACCC
TTACAGGGTGTCGCTATTTCCTCACCTTCACTGACGATTTCTCACGATACATGTTCATCTATATCATCAAGAGGAAGTCGGACCTGTACGAGTGCTACGA
GGATTTTCGAAAGAAAGCCCAAAACATGTTCCGCGCTGATGTCGGTCAGCTCACATATACTGAAAACATGTATGACCAGGAGATTCGTAACCTCAAAAGC
GACAACGCTCGTGAATATGAAAAACTCGGCAAAATCATCTTCAAGAAGTATAACACTCATGCTCAGTTTACAAATGCCTACACACCACAACAAAATGGTG
TTGCAGAGAGGCGAATGCGTACATTACTCGAACGCACTAGAGCCTTCTTGATTGATGGATATCTCCCTCATGTTCTCTGGGGGGGGGGGGGGGGGAAGGG
GAAAAAACGTTTGAAGCCCTTCCCAAATTAACCCCACACTCGGTTCCGAAAAAATACCCCCCCATAAAAAATGGTTTGACCGAAAACCCTTCCCCCACTC
AACCCAAATTTTTGGGGGCGC