Description :
From Genome Similarity Track
Location :
Scaffold_1444:2041- 3195
Transcript NameFunction/comments
Phypl_g13423hypothetical protein PHYSODRAFT_486521

Sequence
1154 bases(100 bases per row)
TCCAGTTGCAAATTCTACGCGCTGACGGGCATCTGCACGTGTGGCTCTGCCAGGaagtcgctcagcagcttggaaACGATCTCGGATCGCCCGCATGGAG
TGCACCCGGAGCGATACGAAATGTCTTTGGCAGCACGTAGTAGCAGATTCGTGAACGTTTCCAGGCGTTGCTCGCGGTTGTGTACAACGTAGTCGTACAA
GCCTGTGGCGATTGCCACGCCACTGCGGGTTGGGAAGCGCGGCGGAAATGCACCCGAGTGGGTGAGCTCACGTACGCGCGAGCAGTACGGGCATCACTGC
GAGTGGCTCATGTCCTTGGGcgccttcacctcgtcgctgatgcgctcgcgcagcgcgcggaACGCTGAGTAGCGGTGCTTCACTTGGTAATCCGGACTGA
GATCGTCGATTGTACCCTTGTTTTTCTTCGTAAGCTTGGAAATATCCCTTGGCGTTGAGTGCTGGAACACGTTTAGCACGTACACTGTCacacgttcttc
ttcatcgaagGCCCTGCACATGCGCACATGGTGGATGCTGTTTAGCGCGACGGCCATCTTGGCACGAGAaagctgcgagagctgcaaGTATTTGGTCAGA
CTAGAGCTCGCGCGGGTACACTCAGTGTCTGTGTCAGTGGCGATGATTGCCGCATCGAAGTCGTAGTAGTTATCACGGGGCATGGTTTGGATTGGTCTTG
TGTCTACAAGTAGTAGACTTGCTCCTGGCTCGTTCTTTAGGCGGTCGTTTTGGTTGTGTCGGTTAGTTGGCTTGGAGTCAGGTTCTCTCTAATAGAGCCC
AGTCTATTGAAGttgactacatgtacagccaTACTTGATGATGGTGTAGGAAACTCCAAGCCAGTCGGCGCCGTCGAATCGAGGGTCTTGGGGCAAGGCT
TTCCATCCAAGTGCACGCGACTAGTATTTAACCCAGCCACTTTTGCTGACGTGGTTCATGTAAAGTTTGCGTGGGTCTGCGCCAACTTCAAAGGCAGAAA
TGATGTGTTTTTCTCTATGGACCGGCGACGATTTCGGCGATGCGGCAGCCAAAGCGAAGTATAATAGTCATCTTCACTACATGGTGCTCGCGGGTACGTG
CTTATAAACGAAACCAGCAACGAACGCTTGCTTGCAACTTTGTGATGAGAAACT