Description :
From Genome Similarity Track
Location :
Scaffold_7:204069- 206327
Transcript NameFunction/comments
g5807.t1hypothetical protein

Sequence
2258 bases(100 bases per row)
TTGGTGGACGGGCGAGCGCTGTGATACCAATCGTCGATGCTTTTACCATACTCTTTGACGATATCGAAGGGCGTGGCGTAAACTGGTGGGTCTCTTGCAC
TCGTGGCTGCCCCATAGTTGAGCAGCGGGCCGTCAGTGAGCACCTTCCAGTATCCAAAGAGCTCGGCTTTATAGTTGGCCGTATACAGCAGCTGAAACAT
CGGGAGGTTCACGAGCACCTGACGCAACGCATCCCACTGGTAGCAGCGCTTTAGATGCCATGGCAGTTCCTCGACGCGGCGGAACGTAGTTGGGTGAATG
CGGAAAAAACGAATGAGCCACTGGTGGTACTGCTGCTCGGCGCGTTCACTGCCGATATATCGCCACCAAATGACGTCGCGCAGGATATCTTTGCACATCG
GCAAGACCACAACCTCCTGCACAAAGAGCACACTGAGCGTTCGAAGAGCACGCAAAAGCGCTTGCCACTCTTCTTCGGAGAATGCTTGTCCCAAGCCCTT
TTTCCCTTGGTGATTGAAAGTTGGTTCTTCTTCATCTCGGTGGGGTTCTCGTACACGGTGTTTCCCGCGCGCCTCGGTTACGATAGCATTGAGGATGAAG
CGCAATTCATTCAGCAAAAGCCCATGACGACTCACGTACAGGAGACACAGCGCTTTCCCGAGTAACTCTCCAAGTGGGGCAACAGGACGGCCACCAGTCA
GATAATCTGGTCTGTTGCCAATTTTCAGGGAACCACTTCTGTTTGTTCGAGGCTCTGTTGGAAAGCGTTTGAGCTTGTACTGCGCAGCTTCAAGTAACGA
ACTTGTGGCCATTCCCTTTCCGGAATCAAGTGGTGGTATCACGGACCCACCTTCTGCTGTTGAGGACGGATTTCGAGCTCCTATGTTCACGAAAAGCTCT
TTGGTTTCGTGAACACTTTTGACGCGTTTCATTTCATTCCAACCTGTGTTTGTGTCGTTCTCGCGCGGACGAAAATCAATAACACGCAAAGAATCGCTGG
TCTCACGCACGGCAGCCTCCGCAGCGGCGCGCGCGAGCTCAATTTTTGTGCGGTTGTCGTTCCCGTGCAATGAATATGTTCGCCCAGAGAATTGAGCGTC
ACCTACGCTCGATGATGATTTTCGGATTGAAGCAGAATTTGCCACGGACGCCGTAGCGGTGGGAGCGTTGTCTTCGCCGTCGTACTCGAGAAAGAACTGC
ATCGCATCTTCTGTGGAGAGTTGGTCGGGCTTGTAGCCGATCTCCATGCTACGAAGTACAGACTCGATTAATTGCCCCACACTATCTGCTCCCAGCCAGC
TCTCGAAGATTGCGTGGATATTAAACCCCTCCTTCACCGCCCAGAACAAGGCCGTAAGGAAATTATTGAGGAAATGAGGGCTGGCGCTCATAGGCACGCC
AACAAGCGCATTCTGCTGTATCTCGAAAAGCTGGAGTCCTGTGGTTGTTTTGCTCGCACCTTCGTCTTGGTCGCTATTGTCGCGTCTCTTGGAGATAAAT
TTCTTGACGATGTGTCTCCTCTCTTCCTCGACTAAAGGCAAGACGTGTATGAGCTTCCAGTTGCGACGACCAGCCTCCACTTTAATCCTCTCAATCATTT
GGGCACTAAGGCTCGTTTTCTCGTAGTAGTCACCTCCCAAACCGCCTTCATCATTGGCGCGTTCGTCACCACGGGGTACAAGGCCGCCATTGGCGTTAAG
AACTTGGGATACCTTGGCAGTCGGGTAGTTGAGAGTCCCCGAGAAGATGATGCGGACGTTCGGTGGGAAAGAGAGGGGCACCCACTTTAAAATGCTCTCT
CCATTGTTCGTGTGCAGTCGATGCAGCCCGTCGACAACGAGAATGACGCGACCCTTTTTCGACGCAGCCTCTAGGAAGCGTGGGAACTGCCAACTGAGCC
GTTCTTCGACGTCCGGGATCTCTTTGCTTAGCTCGAAGTACTCCTTGATCTCGCGCAGGATCCGCTCGAGCAGATTGGACACGGAACAAGATTGTCTCGA
GCAGCCCACGACGTGCGAGAAGATGAACTCCGGGTACGAGGACTGCCAATTCTGGAACATTTTCTTGCGGCGCACGACCCAGTTCGCCAGGAAGGCGCTC
TTCCCCATGCCGCTCTCGCCTAGAAGGATCACAGGCCCCTTAGGCGTGTGCATGGAGTCAACGTCGCAAAATTCATCCAGCTCCCGGGTCAGTCGGGGGT
CTTCGTGATACACAAAGTCGCCCGTTTTGAGCCGTAGCCGCATGAACCCATGATGGAA