Description :
From Genome Similarity Track
Location :
Scaffold_608:204- 6860
Transcript NameFunction/comments
Phyag_g6985RING zinc finger-like protein
Phyag_g6986protein kinase, putative
Phyag_g6987Major Facilitator Superfamily (MFS)

Sequence
6656 bases(100 bases per row)
CGTCATGGGGCACACGGCAAGCGTGAATCGGAATCGGCGCAGTTCGACAGGGACGCTGTATGGAGAACCCGCGGgcgcggctgcagcaccgcgTGGGAGC
TACACACCAGCGCAGATGCAGGCGCTGTATCTGAGTCGAGGAAGACCAGACATGGCGTTCATGTCCAATCAAGGGCACACGCCCGTTGACGTcccagagc
tgcagcagacgtgCACTGTGAAGAACCACGTGAACCTGAAGAAGGCCAGTCTCAAACTGCAGCGATCGCCCATAGATCTGGAGCAATACGCGCTGGAATT
CCAGTTCGACGCTACCAAACCATGTCGGATCAGTGTGTATCTGGTGGCTGGAGAGACCATCGACGCTGATTCTGGCGGCTCCAGCTTTGCGTTGGTCCAT
GCAGACAAGAACCCGGTGCTGACTCAGCTCTTCCCTTCGGGGCTGGGGCAGATCTTCGTTCTCAAAGGGGGCGAGACAGAAGataaagaggaggaagagg
gtCAAGAGAAACACGagccgccactgccgctATTGAACGTCTCATTGTACGACCCTGATGAGCTAGTATACAAGGCCGGCACCACACAGTTCCCATTGAT
CGTTGTCCTCGAAGTCTCGTCGGATAGTACGTGCATTGTTGTAGCGgcttgacgtcgttggcgttgTACTTATGACTTCAATGTGTTGCTCACAGGAAAA
CGCCCACAATCTCAGTCGACATTCTGCACCTTCGTGAAGAAAGGTGAAGACTTGTGGGATATCAAGATGCTCAAGCAAAAAATTATGGTACAGAACAGAA
TGGATAGGCATCCGAATTGCTGGCGTTTGAGTGTGCTAattcttgttcttgttggaTCGATGTAATAGGTGGACGGACTGacgtacgagctgcaggagat
ctACGGTATTGACGGatcagtggcagcagccccTAAAACTGAGCGcaacggcgctgctggagatggccaagctgACACAACCCAGACTGCCAAAGATGAG
ATCGAAATTCCTGAAGGCGCAGAATGCATCATCTGCTTGTGTGAACCGCGCAACACGACAGTTCTGCCTTGTCGGCACATGTGCCTATGCAGCGAGTGCG
CTGAATCATTGCGCAAGAGCGCCAGCACGTGCCCAATCTGCCGGACGCCCGTTGAAACATTACTCCAGATCCGTGTCGAGGCAAAAGAGACAACGACAAC
TGAGactgaagcagaagatgtCAAGTGAGCTTGGGACGAAGGAGATTATCGACTTTAGCGCATCGTATCAACCTAAATACACTTATCAATCAACAAACCA
CACCATATCTTGCAGGATTCAGGTCATACCGTCAAGCAACCGCATGCAAAGCAGTCGTCAGAAACAGAACGAAAGAATTTATCAAATTACCTCTTCCTTA
TCCTCTCGCTGTGCTTGGACCACCTGAATCAAAAGTTACCCCTCGGCTTTCGTCCCGGTCAGCCCTTCACACGTTGATCGGACTCTCTATCTGTGCAGAC
CTTGTCTTGCAGGTTACATGTCCGTCGTTCACGGTCCTGCAGCTGGGTTGCCCTTGATTTTTCTTGTGTGTTTTTGGTTGTTATCTTGTACAAATACTGA
TGGCGCTCCGACGATGTGTGCTTGGTGGTGAAAAGACTCGACAAAAGCGTGCTCGCTAAGTTTTGCGTCCTTCATTGTCGATTAGTTACACCAAAACACA
TGCAGATAATACGTTACTGTCGCACCGCATCCCCTCCGCTGCCCTGGCctgtgctcgtgctcgtctcGCAGACTAGATCAAACTGATGCCGTGCTCTGCA
GGTCTCCATGCTGGGCTTGGGACCGACCGACATCAGCTAATTGTTTTTCCTCCACATTCCCTTCATCTGCACATGCGTCATAAACAACCAGTCAGCTAAA
GAAATCGACACCAGGAGAACTTACCAACGATCCGACCTTTTGCATAGATAAGCGACTTACCAAGTTGGCGACTTGTTCGGGGGCGTCGCGGAGTCTGTTT
GCCGTCGAAGGAGTCGAGCTGACATCGCCCGGTGAGCCATAGTAAGGGCTGCTCTGGCCTTTGGCAGGATAACCCCCGCGCTGAGATCTAGGCGCATCCT
CCGCAGCGACTTTCGCATTCAGTTCtcttgaagacgacgactgGACATCGGCGAGTGTTCCCTGACGACCATCGCGACCGGGGGGACTGCCACCGCTGTT
GTTGTCAGCCCGTCGTTTCGGACTTTGCGAGCCTCCGTGGTTAAAGTTGTTGTCTGCACTGGAATTGGAGTCGTCAGAAGTTGTAGGTGATCCGACTTTT
GCAACATTGTACGACAACTTGCGCGTCATCATTTCTACCATCTGCTcccgcttcttcagctcgcttTCCCGACGCATGTagtccacctccagctctgcaA
AGACGAATGGAGAGGGGTTATAAACACTTCGACACAACATGCAAACAGACATTACTGCTGAACTCAcctttcagcttcttctcgcgaGCCATCAAAGCAG
CCTCCTGTCGGCGTAGGTCCTCCTCAATGCCCAACaactccttcatcttctggtTGTAGGACGTCTGCAAGTTCTGATCGGCGGCTGGCTGCGGGTTGTT
TGCCGCTGCATACGCACGTAatctctgctgcagctgtggcaCACGCTCCAAATCCTCAATTCTCGGTCGTCGAGAGCGTTGTCTGTGCAGCATCCATCGG
ATGACCTGGAAGAGACCCTCTGAGTACTGCGACGGGATGCGCGTGAACTTGCCAGCATTAATCTTCTTTGCAAGTGCCAATTGATTCGTAGCGTCGAACG
GAGGTCCCAGCGTAGCCATCTCATACAGCAAGCAACCCAGTGCCCAAATGTCGGAACGGTCGTCGTAAGTCATCTCGTTCACCATCTCCGGACTCATGTA
GTACGGAGTGCCGACATTCGTCTGGGCGAATCGAGACTCGCTACTAAGCTCCTTAGCAAGACCGAAGTCACCGAGCTTGGCATTGTTCTGCAATAAAAAT
CAGAAAACCTGTCAGAAAAAAGCTACCCAAAAAACAAAAGTAGAGAACAgagaaaaaaaataaaagTTCGTACGTTGGAGTCTAGGAAAATGTTGCCGGG
CTTGATGTCACGGTGGAGAATAGGTCGGATGACATTGCCTTCACGGTGTCGGTGGCACTCCTTCAGTGCCAGGAAGATGTGCGTGAAAATGTGCCAGATG
AAGCCCTCTTCGATGTAGGACCTGCCCACAAAAAACCAGAAATTCACCCACAAAAAAGTCAGAAAACTCAAAGAATCTGATAAAAAATGCCACAAGATGC
GTCTTTTGGGATCGGCATCAACGTACCCCTCccgtttcttcctcttgatgAACTGACCCAGGTCACCGCCTTCGCAGAACTCCATGACGATGTAAATCTT
GGTCGCCTGCTTGTCGATCACTCGGTCCAAGTACCGGACAATGTGCGGGTGCCGCAGCTCCCTCAGAATGTTCACCTGCAAGAACCCCCTAATGTCAGTA
TATTGCACCCcctgctgccttcaacagGCGGGCGCTGACGCACCTCGCTGacgatgagctgcttctctttCTCGCTCATCGCGCCGTAGTTAACTTCCTT
CCACACCAGCATCTACTCGTCATAGCGTATACATTCCGTCAGTATCAAGTCTTGCACGTCACAGGTGTttccctgctgctgctcacctTGCGGTCGGCCT
TGCGTACGATCTGCGTGACGACGCCGAAGGAGCCTTTGCCGATGATGCGGACCTGTTCGTATGCGTCCATCGTGGCTGCTGGCTATGTGCTGAAAAGGGA
GGGGGGAGGGGAGGCTCTAAGGGAGGCTCTAGGGAGGAGGAGTTGCCGCTGATGGTACCGCAAGAGGTGGAGTCGAGACGAAAGAGCGACTGACTAAGTG
TCGACTCGCTGCGGGGTCGGtcgtcttctcttctctcCTCTCCGCTGTTCTTCGGTTTGTGGCCTGCTTCTTGCAATTTATCGCCTCGGCAAACGCCAGC
CAACTCTCCCCCCCTTTTCGACGACTGGGTAGTCAAAACGGGCTCCCCTTTTCCACACGACatactgaaaccaagtcaaATGAATCGAGGAAGGAATGTG
GTAAATTACGAGCATGTGCGGCTGAGGCCTATCCCTCATATGCTTTGGCTAAATTTTAGTAGGCTGTTGTCATGGTATGCGAAAGGTGCTTCgttgcagt
gcagtgcagtggCCACTGCCCCGATAGGTATAATACCGAGCGAAAGTTTGCGCGCCGAAATCGTGTTTGTTGTCGTTTCAGACCGTCAGTTTACAACGCC
ACACTTGCACCGCCTGTGACCGTTCATTGTGACTTCCGGGATGCATTCTCGCCCGGTATAGGCAAGTCAGTTCAAAAAGCCAGCCTTGCGCGGCCAGGCA
GCATCGTGCAAGAGCCAACACAAGGCGGAAGAGAAAGTCGAGGTCGCGCTTCGTGCATTTCAggtcgttgttgttgttgttgcagacgAAAGCGATTGCG
TTTGTTGCTTCACGCTCTGAGCACGTCCACATATGCTACACGATCGATTTGATAACTGCTTGGTTTGACTCGCtcagttgaagttgaaccGAAAATGGCT
ACAAGAACACCAACAGCTACTTGTGCTCGGCAGCtagcagcgcctcgttgTCGAGGGCGTCCTCATCCAACATGAGCGACACCCTTCTCTTGTTGGGGTT
CGTGTGGTTCAGAATGGAGCCATTCTGGTAATCCACCACATTGAGGGCAATGCCCACGAGACTGCCCAGCACCCCGAATGACACGAAGAGAAGCTCCACG
CCTGGAATGTACCGGTCGTCGTGGTTGAATTCCGCTGCCACGGCCAATGGGAACAGCGCAAGCCCGATGTTCTAAAAGATTTAACAAGCAAATAGGTAGA
AGGTTAGGATcaagcagcatcgacttcTGGTCCGCCACGAGCGACAAAAGTGCCGAAACGAAAAGGATGTCGATATCCCTGAAAAGTAGGGGTGGACAAC
TTCCATTTCATCTTGGCACTTGGTTTGCTCCGACGGAGCTGAGATAAACGCACCTGGATGGCAGTGATCGCACCGTACGCCGTTCCGACGTGCTTTGCCT
CGACCACATCTGCACGGGCAACAGTACAACGAGATTAGATTCCTGAAAGCTCGCATCCAACACGTAACCACTTACATGGGACCGAAGGCCACAGAGCTGC
GGCGAATACACTGTAGGCCACACCTTGCAGCACCAATGGCACGTAGAGTGTCACTTGAGTCAGCCCCAGCATGATGTGGACTGCCGTCAGTGCGAGGGgt
gccaccaacgccaaAAAAGCACGGAGACCGATGCGGTCGACCACGAATCCAAGGAACGGTGAGATGACGGCGCTAATGATGTACGGGATGGACATTGGCG
TAGCAGCCTGTTGAGCTGCATTCGTTTTCGTGGCGCAGTAAGTCTTTGTCAGTGGCCCCAGCTTCCATGCCTCGTCGTCACAATTGATCTTGTCACCGAC
AATCAGTGGGGGCGAAGTCGAACAGTCCCACTGATTCAATGGTTCTTTGATCGTGCAGTTCGCCGACAGCAGGGGCAGTGGCCACCCGTAAGGAGGAACA
CTAGGACATCCCGGAACGATCTCTTGGCAATCGATTTCGTGAATATAGAGCCCCTCTCCGCATCGTCGGCACAACTCAGGGGGTTCCTTGAAAAAGTCAC
GCTCCATGAGAAGACTGCTTGCAACGTTATTGAAGGGGATGACACAACCATACAccaccaagcagctcaacgccagcagccaaAACGCTGGTCGGAAATG
CTTGATATCACTGAAGTGAATGCTGTCAGCAGCCATAACTCCCTCTTTCTGGCCCTCCTTCGTCAATTTCTCCGCTCGTTTGTCGATCGGAATCACAAGC
AGCACCGTGAGGGCAGATACCACACACATGAGAGCACCCACCCACAACGCCGTGGAGACACTCGCCGCTTGGGCCACAACCGGACTCAGTTCGTTGTTAA
TGACACTCCCCAAACGAGCGACACTGAGGTTGATACCCAAAGCGAGAGCAAGCTCACTATTCTTGAACCACGAGGCAACGAGTGTTCCCTGCGCCACGCC
CAAGCTCTCTCCACCGAACCCAAACACCACTCGACCGAACTACAGCAAGAGATGCAAGAAATGTCAGTCCTATTTTGCACCACAGGATAATATTGTTTGC
CCTCACCAGcatcatgttgaagctggagagcgaGCAGCCCGTTGCAAAGATCAACTGTCCCGTTAGAATTGCCGTCGAGAAGGCGAACAGCATCACGCGC
GCTCCGAATCGATCCACCAATACTCCGCCAAAGAACGGCAGTAAGATGTTGGGGATCGAGTATAACGTGTACAGCAGGTTCTACACAGAGACAGATCCAT
AAGTACTACAGTAATTCAGTAGTTGTAAAGATCTCGGTGATGAACGTACGAAGAGGAATTCGTATCGATCTTTGGGGATGCTACTAaaccgctgctggag
ctggctcTTGAGCGCCGCGGGGTTGTCGAAGCAGTAGTAGTTGCCGATCATCAGCACGCAcgacagaagcagcaccagccaccGCACACgcatctcgctc
ttctccatGGCTGCCCCTGATCTTCTTCGAGGGGCGGATTCAGTAGGACTCAGATC