Description :
From Genome Similarity Track
Location :
Scaffold_1576:204- 3279
Sequence
3075 bases(100 bases per row)
CTCCCAATAACCACGTGCCTCTCCTCTGTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGACCTTGGCA
ACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAATACC
TAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTGCTTGGCTGGATCA
AACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGCGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCTCCGG
GATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACCTGGGCTGT
CCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGGTCGAGAGTTGTCTCCGGTCTTAGCCGTTCGATCGTTGGGC
GCAGTGAGACAGATTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGACTCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTC
GAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCAC
TTCCTCAAGCTCATCTGCGTCTGGAAGACGTAACACGGTCAGCCTGTCGGCCAGATCCACATCTCCCAACGTCTCGATGAAGTGATCCACATGTTCCCGC
AGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCGGC
GAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAGCTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCC
CAGCTGCCGATACCAGCTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTG
ACTTTGCTGATCCATGTTCTCGCTGGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGGTCCGATATGGCTGAGATCCGTACCCTCTGGATCATGG
ACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAGCTCATCATGGAAGTCGTCTCC
CTCCACGGATTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTC
ATCGCAGCTTCGAAGTGCCGCTGCAGGGTGCCCGAGAAGGTGTCGGAAGAGCCGGTGGCCGTCTGGTCCACTGGCGAGTCAGAATTTGTGGGCGATTACC
TTGAGCCCGATCTGACGATAACCCCACTGGCTTCTTGCCGGTTCTGGCTCGATCCTGGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGGATCCCGA
GTCTTCATGTTCACAGGGACTTCCTCTCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAACGTCATGCGTCGGGGATCGGACGA
CGTGTCGGATCCATCTTCCGCCGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCG
GTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGTGGATACTATGAGATCCTAGTCTAGCTCGAAGATATCCTCTGCGTCGAACACGCCAGCTACGA
TGCCCGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGACGTTTTCGTTGGTGCTCTCACCGGTTCCTTGGATCTTCGATCTGT
CGTGGATTCAGGATCTGCATGACAGGATCGTGATGTAGGAAGTCGCGTAAAGCTTGGTGGTGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACT
GGATTCAGCTTGGTCTTCTTCCGACTCTGAAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGAGCTT
GGGTTTAGGTACGGTGTTGGCTTAGCCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAA
GATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCC
AAACCTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCA
TCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCATTATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCGGA
TCCAGCTTACCAACTGCACCCAGGCACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGG
GCGGGATCTTGCTCTCTCGGTAGCTTCCGAGGAGTTCAAGTGGTGAAGCTTGAGCGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATC
TTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATTCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGG
GTGTGTTCCCTTGCCTTTGTAGTTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGA