Description :
From Genome Similarity Track
Location :
Scaffold_1632:204- 1545
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1632-fgenesh-gene-0.1Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family

Sequence
1341 bases(100 bases per row)
TTACATGGTGTACATCTTGATCTTGAAGAAGAAGATCGCGATGCCGACAGCAAAGACTGAGAAAACGCCGCCGAGGAATACCGGGAGCTTGTACCCGAAT
GACGTCTCCACGAGTGCCGAGCCGATCGCAAAGTTGAGCAACTGGCCAAAGCACTGCGCCGAGTTGAGTGCGCCGACGTACACGCCGATGTCGATTTCGT
TGCCCATGACGTGGACGATGATCGGCACCAAGAGGGCAAACGCGGCTGACTGAGTGACACTGGTGATCACCACGATGATCACGTCGATAGCGACAACCTT
GGTGAACGCCATGATCATCAACAGGCACTGCGGGATGAAACTCACGACGATGACCCACTTCGTACCGATCTTCTTCACGAAGAATGGGATCATCCAGGAG
TACAGGTAGCCGACGATGTTGTACATCAGATCCGTGGAGCCACCGGCGAGACTCACGCCTTTGTTGTAGTCATCCTGCGCCTTGGTGCACATAGCGCCAC
AGCTGTCGGCGCCTTCCGCGCTGCCGTCGTACACTTCGAACCCGAAGAACTGGCCCTTGTTGCCGTTGTACGCCGTGTATCCGTAGCCAACACAGAAGAA
GATCGTGCAGTACACAAACAGCTGCGCCGGGAGCGTCTTGAGCGCGTAGACAATGGATCCGAACGCGTTCGTCACTTGTTTCCACGAGCTCGTGCTGTCG
TTCTCGTCCTTCTCGAGAGGCTTCTCCTTACCGGCGATGCACGCAATGATGACCGTGACCATCATGACGATCGACAGCATACCCAGGAACCAGCGGAGGC
TCTTATGCGCAGGTCCAAAGAAGTAGATGTACCCAGCTACGAATATCGCGCCAACGAGCTACTAGCCCTGGCCGATGGACGAGCCGAGCGTCTGACGATC
TCCAGCGAAGTCGGCGATGAACAGATACGTTGGCGTCTGCACGACGTTTACGGTGACGTCCATCCACGCGTACAGCACGATGGCGAAGAATGTGGTCCAC
GGACGACTCGTTGGCTCGCCAGGCTGGCCAGTGCCGTAGTCACCGAGTGCTTCGCCCATCTGCCGAGTGTAGCCCATGAGCATCCAACAGACCACACTGG
CGATCGACGCGTACACCAGGAACGGGCGACGGCGGCCCCACTTGCTCGTGCTGCGGTCACTGAATACGCCGATGATTGGACCGATGAAGATGCCAGTGAT
CGGACCGATGAATTGGGTCAGTTGCACCGCGTAATTGGGGAGCATCGTGCCGAGGTACGGACCCAGCGCTGCGAACTGCGCCGACCAGGTCATCTGAATG
GCGAGGCGCGGGATCGAGATCAGCAGGAGAGTGAGGACGGA