Description :
From Genome Similarity Track
Location :
Scaffold_4:2039204- 2042720
Transcript NameFunction/comments
Phyin_T30-4PITG_03518Putative uncharacterized protein
Phyin_T30-4PITG_03519Putative uncharacterized protein

Sequence
3516 bases(100 bases per row)
AGACACGAAGCGTGAACTTGGTGTCAATAAAGTCTACAATGCTGACCAAAGTGGGATATTATTCGAATATTTACCGAAACAAACAATCAGTAAGAAGGGT
GCAAAGACAGTCTGGGTAAGGTGTGGAGGAAAGGACAAGGAACGCTTCACCGGTATGTTCCTGGCTGATTCTACGGGGAAGCAGTACGATACATTCTACG
TAGTGAAAACCGAGCCTTCAAAACTCCCAGAGAAAGCTGCATATAACTACATCGCCCAGCACGGCTTTGGCGATAAGCTTTGGCCAGCAATGAAGGACGC
TCAAACACAGCTTGGTGTGCAAATCTATGGCAACAGCTCTGCTTGGTGGAACTCCAACCTTTCTGTCGCATTTCTGGACTACCATTTTGCCAGCAGAGAC
GAAGCAGAACCAATTCTTTTGCTTTGGGATGACTTCTCGGCACATTGGACCGATGAAGTCAAAAAGCATGCAACGTTGCTCAACGTTCATCTACTTAAGG
TTCCCCCTGGACTTACTTCAGTATGCCAACCAGCAGACATTTCGTGGTTCCGTCCTCTTAAGCAGCGCTTACGAAGGCAATGGGTGAACTTTTTATCGCA
GCAATTGAATGATTACTCCGCTGACGGCTCCCATGGGAAATTCGAGCTTCAGCCTCCTTCAAGACGAGAAGCAGTGACTTGGGCAACGACTGCATGGAAG
CAGTTAGGCGAAGTTGTTATCAAGAGTGGGTTTAACCCGCATACAAAACGAGCTATGACTGAATTTGCCGAAAACGATGTTATTGAGCAGATGGAGAGTT
TGCAGTTGATTGACGACGCTGTAACAGTTTGCGACGACGACGATGTTGTGGAGCACTGTCTTGATGCATCAGATGGTAACCCATCCAGCATCAATTGATA
GATGTGCAAGCTGCATACATACATAAACGTAATCTTGCCTACCTATAAGGTTTTTCATTTTGTATGCAATTTGGTCTGTCCGGAAGCACAAATGTTCTAC
AGTACTAGGATGCTGAGAGAGAAGGTGGTTTCGGTACGCCTCAGAACGGAAGGGATACTTGTAAAATTTGTTAGTCTGGATCACTTTTCTCTTGGATCCC
ACCTTCTCTTCCCTGCCAAACGCCATGCAAAAGCGGCATGCAACAGCCAGTATGAAGCCGCTCGTTGGACTTCGCTCACTGACTGCGAGACCGAATTCGA
GAAGATGGCTATCTTGGAATGGGGTTGAACGACCTTTCTGTTTGCCAGACATTCGAGCCTGTATTAGCTGGTACGGGGACTCGCCATTCCCTCTGTCGTC
CTGCTCAGCCATAACACCGTGGAGATTGATCTGGAAGCCGCCAGTATTGCAATCCAACGACGGAGAAGAACAGTTTTCTTCATGAAACCTGGCATTTTCT
AAGAATAGGATATGGCGCGAATGCCAGAAATAGATTGAAATGCCAGATTTGTAGATGCCTGGTCAAGAGAATAAAAGTGCCGACGCTTTTCCATTCCCTC
TTCTTCGTCTCGGTCTCGTCTCGCAAGAGACCCGCGAGGCGGAAGGGTCTTTGCATCGATCACACAAAACGTTCTAAAATTCGTTTTTCAAAGAATAGTA
TTCTGGTATTATATTAAATACAAATGTATTAGAATATAAACATGTAATTGAATACTTCAACTACTGAATTTCTGTACGACCATGACTTGGTCATGGTCGT
ACAGCGTCTTGTCGCTGCTAGTGGAGTGTAGTCGGGTGATGCGGGTGAGCGGAACCAAGGTGCGACTTGGAGACAGTGTCATCTACGAATCTGAAGTGGA
TGTGTTCATCGCTTTGGGGCTCGAATACAAAGACCCCACCGGACGCAACTGCTTCGACATCAAGTTTATTGAGGAGGATGAAGCTAAAGCCAAGCGAAAC
TCTAACACCAATGGAGCTGGTAGCGAGTAAGGATACACTGTATTCCGACATGTATACCTTGAAGTGATAGCACAAAGTTGTAAGCTCAACATGTTTAACT
TGGCAAAAAATGGCAACTTACCGATTTTTAAAATGGCAACTTAGTATTTTAGAGTCAATTCAAAATTGATTTGAATAAGTGTCTAACTTTGTCATGATTC
AAATTTGGATAATGTCACGCTATAGGTCGCGGGTTCGAGTCCTGTTTTGGAGACACAGCCTGATTCACGCTGCAACTCACCTTGCTCAAGATGCCGCTGT
TCCTCGCGAACCTGGCAATGTCCAGCTACTTTCTGGCGCTGTGCTATGTCCTGCTCACAGCCATGACAGTTAATAAGTACCTAGAAGTGCGGGGTGTGCT
CAAGCGCTTACAGCACACGACGTGGAGCACCGTACAACTGCTGATTCTGAGCTTAGCCCTGGGCTCCTTCTTCCGGTCAGCCACCTTTTCTACACTATGC
ATCCTAGATTCCCAAGCGACCGCAGACCTCCCCACTGGGATTTCGGGCGCTAACCCGTGGGTGCGTGGAGGGTTGCCGTCGCATTTCGGAGAAGACGCCG
AGGACACAGATGGAGGAGACGCAGCAGGGAGCCACGCTGAGGCGGAGTTAGATTTCTACAACAAAGTGGTGGCTGTGCTGTTCAATTTGCCTGATTTCCT
CTTCGTTTCGTCCTACTTACTGCTCGTGTTGGTGTGGGCTGAAGCTTTTCAGTCGGTACGATCTTGTCGGAGATTGTAATGTTGATGGTAGAAAATCTAA
CAGCTTTGTCGCCTGTAGTCGCGGCGTCATTGGTTTTCCGCAGCAATGTTTAGACGCAAGTGGATGATTTTCTACTTAGTCTTCAACGGAGGACTATACT
TGACACAGCTGGTGTTGTATGCTAGTCTGTTCCTGTACGATACGAACGGGATCTTCGATCACGAGAAGCAAGATCGCCTTAGTCCTGTACGTCTCGTATG
TGGACCTAACATACTTCGGTGCTGTTAAAGTTGACATTTTGGATATTCTGTTGACTGTTCAGATCCCCGCGATGATTTTTTACTTGGTCGCAGCTGCAGA
TTTGTTTCTCCCGATCATCATCTTCTCGACGTGGCTGTACTTGACGCTGTCACTGTCGGGATTTCCATTTAAGTCGCAATCGGCACAGCTTCGGCTTCAA
CGGGTGGGCCGTCTTGTTATGGCATGGAGCTTTGGACGCATCTTGTACAGTGTTATGACGCTGCTCACATTCACCAAGGTAACAACAACTCCTGAGCAAT
ATTGCGATTTTGTTAATGAAGATCACATCTTGAACATTTTCATTGATCCTCTGAACAACAGGGTTGGTTCAATGTGCACCGCGAAAACGCCTCGGTACGA
TACAAAAGTTTGAGACAAAGTTTCGTGTTTTGTGGTGACTGATGGTGTTGCACGTTGTGGAGTAGACACAGGCAATGTTGCTCGTCATCGTGTTTATTGC
AGCAGAGCTGATCCCCATCTATTTGACGCTTGACAAACGTTTGCTCGCAATGCTATCTGTGGAGAACTACGAGCCGCTCCTTGGGAACTCTGAATTCTAC
CGTTAATTCGTCGTGG