Description :
From Genome Similarity Track
Location :
Scaffold_346:20392- 22696
Transcript NameFunction/comments
g12865.t1POM61848.1 Secreted RxLR effector peptide protein [Phytophthora palmivora var. palmivora

Sequence
2304 bases(100 bases per row)
GTTGGAGACTGAGGTGCTCAAGCAGTTCATCTTCGCAATAAAGGACCCGGTCGCTGTTGCCAAACTGTTCCACGTGAAAGAAAAGACGGATGCGAACTGG
AAACTTTGGAAGAAGTACGTGGAGGACTACAACAAGTAGCACCTGAGAGGGATCGCGACCTAAGTCGCCCACAGACTTGTGGAAGACCCCACCAGGTACG
TCAGTTGTAAGCTGTTTACTACGGCATTTCTCTTTCCAGCATCAACGAGTTTCCCACCATTCGTGAGTCTCTTACAGTTTTCGTTTCAATCGACGCGGCC
AAAACCTGCCCTACAAATCACGCGAGGCCAGGAAATCGCTTGAACTTACTAATTTGGAATTCGAAGAAGCACCTAGTCACAATATGAAAATTGTATTTGT
CGGTCTCGAATCGGGAAGTTTGGCCGGGGCTCAAATGATTTGCCTCAACTACACGTCGGTATATTTTCGAAATTTAGAGACGAAGGAAGGTTCCTTATTA
TTTGGGGGCTACGTTTCTCTATACTACTTCTTAACACTTCGAACTAATTCGCAAATCTCCATTCAATTGTTTTTTCCCCCGCTGTGACTAATAAACTCGT
CACATTTACGACGTACTGGCAGTCAATTTCTTGAAGTCAGGTACAATTTTGTGACAGACAAATTGTCCATTTCAGAGTCATCATGAAGAGAGCTCCAACA
TGCATATGATTCCCTAGCTCTGCGGAATTATTTGCAGAAATTGAGATCGTGCTGGCAACGTCACACGTACAGGAAGGAAGCAAAATTAGGTGCGAGTACA
GACTTCGAATTCTTAGCACTGCACCACATACAAAACGTGCTTAGGAGATACTTCACCGAGTTGAACTTCTTGATGTACGCTTGCATCCGTTAGGTAAGAT
ATTTCTACATTGCTGGGGTTTCCTTATCACGTACCCACTTGGTCAATAGTGAAAGCGGTGCCAGTCCGTACTCGGGACCTGTTTCGCTGCGATATTATGT
TTAACAGATCCTCATCAAGGTCGAAGGTCTTGAATGTTCTATCACATTCGTGCAGGTTTTTGGTGGTGCTATCGACGAAGAGACTAACGTTTTGGCTCCT
CGATAAGGCATTTGACGAATGCGGACTTGGACTTATTGCCGATCTGTTACATGTATTAGGGTGATCACGGACGTTGTGCTCAACAACAATGTACTGCACA
TGTTGAGATAACACTATCCAACCCTTAATCTATCTCGATCTCTGATGTGGAATGTTCAGCAAACCCTCTCGCATGTATCTACGTCTCCTGCTTTCCTTAC
TTGTTAATCTTCTCTGCATTGGGTTACTATCTACAGGTACGGCCTCAGTGAAGAAGGACTCGGACTCTGCTTAAACTGGCCATTTCAACAGATTGCGTTT
TTGACAATGCTCAGCTGGATTCGTATACCGAATGCCTGAAATCATTCAATGAGGAAGGTCTGCTGAAGATGCTGGTTACCGGCCAAAACTCCTAACGCAT
TGGCGCCACCAAGCTGAAGAACGACATGGACCAGAGCTGGCTGGACTTCACAACCCCGCCAGCTAAGATTTTCAAAACGCTGAAGTTAATCAGGCTGGCG
GGGACCGTCTCAGTAGCCCGCTCATGGGTCCAGTACATGAAGGCTTTCAACAAGGATACCCCGAGAAAGAAAACCAACATGATCGAGGCTTTCTCTAAGA
GTTACGGCGATGAAATGTTGGATACGATGGCCCAAGCGGCGAAAAAAAAACGAGCACGGAGGTACTTGTGACGAATTTGCAGCTCAAGCAGTGGGTGATT
AAGAAGAACCCCACCGACATCTACTGGACCCAGTGAGAGCCAGCCGTTGGATTTCGTATCCTGGCAACAAATGTGAGTCCTTGATGTCACGTATAGCTAC
CCTTGTAGATCGGAGGCCTTCATGTCTGGATTCCTCGTTAACACACGTAGTCGCTCAAAATATTGAACTTCAGACTGCGAAAAGCTCACACCTTTGTGAA
GCTCCAGCAACGCAAATACTTGTTTGAAGGATGTTGTGTCGAGGCTTCCCATCCATTAGAGAGAACAGAATCTGGGTACAGTAGCGTCAGCCGACCATTG
TAGGAATGACAAGCAGCACGTGTGCACACACCACGGTTAGTAACTGCTCGCAAACCTACGGAGTACGCTACTATCCATCTGTCAAAACACACAGCGGTTC
ACTTGAGCGCTGCTTGACACTACAAAAATAAAGCGTGTGCTCTTCGGGACATTTGTGGGCCTCTCCGTTAGCTGAAGCACTGTTCATAGTGATATGTTGG
TTTC