Description :
From Genome Similarity Track
Location :
Scaffold_703:20391- 22680
Transcript NameFunction/comments
Phypl_g10437Calmodulin

Sequence
2289 bases(100 bases per row)
AGCATGGCATGACGCGAGGCTGCATCTCCGCCCAACGCCGCGCCGGCGCTGATGCTTAACACGCCGATAGCCGGAGGCCGCTGAGCGCGCGTCGCGTCGT
GAACTGCAGCGAGCAAGCAACAGCGGAGCTCGCGGCCTCTGCCACGATCGCACAGTGGGCTCCACTGCAGACCGGGCGGGCTCGTGCATTCCAGTGCTGG
CAGGGGTCGCCTtctcgccgccttctcccGCCCAAAGCCGAGCGCCATCGGCGAGCAAAGTGCTGCCCGAGGCAtgcgacgccggcgccggcgcaGGTGC
GCGCGATGCTTTGGGCCGCGTGCTGCCTTCGCGGAAgatgctcgagctgcaacaAATCAGCCGAGACGCCTGGGCCAGTCActcgcttcaacttcagtCA
CGCAAAGATCCGGCGCCAAAGGTCGCTTGCACGTTGCAACAAGGGCACGGCCACGTGGCAGTACCGCAAGAGCGCTGTCGGAGCGGCCGGCGTGCCGCGG
GCACGCGCCCCGCCGACATCGCTACAGTAGCAAGTTGCTGCCAGCAACGCTCGGCCGTTTTGTGGGGCCTCCATCGAGATGCGGCCGAAGTGTGTGTGTT
TCCACCTCGGAAAGAGGCCCTCTGCTCCGTCCCACGCACTTCGTCGCAAGCAGCTAAACTTGCCCGCGGCCGTACGTGTGCTAAGGCTCCGTGGCGGTAT
TTGCAGTAGCTAGGGAGCCCTTGCAGCAACCAACGACAGGGCGGGAGTAGTTAAGTGATCCCTCCGCAGACAGCCAAGCCCAACGTTCCGCCAATGCAAG
GGAAGGACGCACTCAATgacacgaagaagcagcaaagcaaTTGATCGCTGTTTCTAAATTACTTTTAAGCTAAAATCGATAGGAGCCGTCCacagcggcg
ccggcgacAGGAGGGAGCAAAGGCGCCCGCGCCTCCCAGCGGCTCCGCAGCACACGCGCTCCGAACTCCAGCCGAGGACTGCGAGGGACGCGACGCTTAC
TTGGACATCATCATCTTGACGAACTCCTCGTAGTTGATCtgtccgtcgccgtcgatgtCGGCCTCGCGGatcatctcgtccacctcctcgtccgtgagct
tctcgccCAGGTTCGTCATGAtgtggcgcagctcggcggccgAGATGAATCCgttgccgtccttgtcgaacACCTTGAAGGCCTCcaggatctcctcctc
cgagtccgTGTCCTTCATCTTGCGGGCCATCATGGTCAGGAACTCTGGGAAGTCGATCGTGCCGTTGCCGTCCGCGTCGACCTCGTTGATCatgtcctgc
agctcggcctccgTGGGGTTCTGGCCCAGCGAGCGCATGACCGTGCCGAGCTCCTTGGTGGTGATGGTTCCAtcgccgtccttgtcgaacAGGGAGAATG
CCTCCTTGAACTCGGCAATCTGCTCTTCGGTCAGCTGGTCAGCCATGGTGGTTGGTTTTCGCTTGAGGGAGTCGAGGGAAATCCAGGAATGAGCGATCCT
CTCGTGGCAACAGCTACAGCTGCTTCGGCTCTGATTTTTTCTGGAAAGTGGACGTACCAAACCTGCGTCGCTACTGGTGGATATTTTCATCGCGCGTTTT
CAGTGGTAGAAAATAAATATGTCCGCACCAACCCAGTCGTACACATTGCCTTTGACTTGTCGTTTGTATGGCTTTGGACGACCAAAAGTGAACGACCAGC
CAAGGAGTAGGCCATAGTGGTGCGGACAGCATTTGCGTGCATTTCCAGCGTTTTTGGTGTTagtgtggcgcacaccacTCGACTAAACGATCGTATCTTC
GTTTTTGTAAAGGGTGGATTGTGGATAAGGAAACGAAGCTGCCAACGGAAATAGCGTCGCAAAACACTGCAATAGTGTACCACAGCAAATTAAATTAAAT
ACTCCTGGATCAACCCGCAGGGCCGTTTTCTGATAAATGACGTGGCACTATGCAATTCGATCGCTGAATGTTATGTCGTCGCTTTCAAGTGGTGTGTTGC
AGCACAAGTGCTTTTCGTGCCGTGGGTCAGAGTAACGTGTGATTTAGACTGGCAGCCCAGCTACCTGTATTATGTCTATCATAATATACGGGGAGGTCTC
AGCTTTTGTGATAGCTTCATCACAGGAGCGAACGAGCTCGCGGTGTTCTCTGGATatttatatccagagtctTAGGTGGGTTCGCTGACAGCATCTTTGT
TTCTCGACACTTTTGAGAAGGAAAAGGAAAAACTATTTTGTTGCAGTCGCACATAGTGAAAGCAAGTACAGGCAATTTCAACTTGATGT