Description :
From Genome Similarity Track
Location :
Scaffold_53:2039- 3395
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_53-snap-gene-0.47Ankyrin repeat protein

Sequence
1356 bases(100 bases per row)
CACTGTACACGAAAGCAAGACAACGAGCGGCATCGTACCTCTCGCACATGCACAATACACGTAGACCATACTTTGCGAACACCGTCAAGTCATTCAATAA
CTCGTGGGATGGAGCTCTCGAGTTACAGGGTGAACGTCTGACCCAGCGCCTGGAACCGATTGCGGCGCTGCGTCGCGTCCGGGAACTCCTTCCACACGCC
CTCCACCTTCCCGAACAGCTTCTTGAGGTCTGCAGGCACGGGACGCGTGTACTGCTCCGCGTACTGGTCCCAACTGCTCGGAGGAACCAACGCCGAGTAC
GCCAGCAGGATGCAGTTCCGCCACTTGGCCAGGCTGCGCTCCCACGCCGAGAACAAACTCGAGTCGGTGGGGGTCTGGCAGAGCCGCGCCGAGACGTCTT
GGAGCTCCTCGTACGCCTCTTCGAACGCGGCCTCGCACGAGATGGCGTGGTAAAAGGCGACGTCGAACGGCGGGAGCGACGAGTTCCACGCCACCATGGC
AGTCTGCAGCTTGGGCGGCAGCTCGGTCGCGTCCTCTCCTCCCACGGCGGAGGTCTCGCTCGAAGTGGCGTTCGTTGCGAGCTTCGGCGCGGCAAACCTC
TGCATGAACGCGCAGCAGTCCTGCTTTGACAGCGGGATGTAGTCGCTCGCCAGCTTGCCCAACTGTGGCTCATTCGATTAGCCTGATTGCCGTCACGTTG
CAAGGGGGCTCTCGCTTACCGAGTTCGCGATCGTCACGTTGGCGGCCTTAGCGTCCATGATGGCTTGCAGCATATCCACCGTCACTGCCGTGTTCTCGCA
CAGGTAGTGGATGGGCGTGTTCCCGATCTGAAGCGGTCAAAGCAGCAGACTCAGCACCATTTCTGGCAACCAACAGCGACGAAGACGCACATTGTTCTTG
ATGTTCATGTTCGCCTTGTGCTTCAGCAGCGCCTTGACCATCCCCAGCGACAGCGAACTGTTCTGGAACAGATAGTGCGCCGGGCTCGATTGGAACTGCG
CATGAATGAGTCAGCATCGTTTCCCAGCAACAGGAACAGTCAGAGCACGGTGACTCTGCCTGGTTCTGCGTGTTCGGGTTGGCCTTGGCGGACAGGAGCG
CCTCGATCATGAGCTCATTGCACGACAAGTTCTCCGCCAGGTAGTGCAGCGGCGTATTCCCGTCCTAGCGCGACCCAACAGCAGCCCATCAGCTCGCCAC
AACGCCACACACACATTGCATCCACAAACGCAGCACCTCGTCCGTGGCGTTGGCGTCCGCTCGGTTCTTGACCAGCACGAGGATCGCGCGCTCCGTGACG
GCCTCGTTTTCGCACAGCAGGTGGAGCGGTGCCTTCTTGCTGTCCTGCTCCGAGCC