Description :
From Genome Similarity Track
Location :
Scaffold_2546:2039- 3260
Transcript NameFunction/comments
Phypl_g15189hypothetical protein

Sequence
1221 bases(100 bases per row)
AAGCGCCTCTATGTTCGCCCGCGTCACCAGCGCTGCGTTCCAGGATGCTGGCTCGgggtcggcgtcggccgGGATGATCCAGCAACGTGGAGGTAGGAAC
GTGAGGCGGATGTCACAGGCTGAGATCGAGGCTAACCGCATGGAGCGGAGCGACTTGGGCCACGGAGCGTAGCGCCTTCGCGCCCACTCAGACGGATCTT
GTACGGGCGGGATCGCCGGAGCGAAGAACGGGACGAAAGGACCTGGTGGAGCGCGCCGAGGAGacgaagaacgcgacgacgagcccgacgaaGACCCGGA
TGATGTGGAGcttgatgacgacgaagactcaTCGCCATTGGAGCCTCCGGAGCCACCGCCCGACCCACCTTGGCCTGTCGAATCCGTGGAagatgatgac
gaagagcgcgaagCACGCcgatgaaggcgtcgacgTTTGGTCCGACCTGAGCGACCCCCGGAGTCGCTGTGCGAAGACCCGGCCTGCGATCCCGCAGACT
GAGAtcgctgtcgacgagatCCCGGGATGAAAGGTGGCGCCGCGGGCGGTGAGGGCGCGGCATCCTCTACGAGGGGACATTGCCCGACGTCGCCAGGAAA
AATCTGAGGTCCgtcgccagcttgagcaggatcatgagcaggaagaggaatCGCAGCTGTGACGGCGAGCCCAGCGGCCGCCTCCAAAGACTGGATAAGT
CCCGCTATGTCGATGGAACCCCCACGGAGCCGATCACCGTAACCAGGTGGGCTGCTAACGCATCCCGAACGCGGTGAGCCGACTCGCGTCCGAGGCGCGC
CTCACGGAGCAACCGACGCCACGCTACCGTTCgttcgtcgcgctcgcgcgtAACTTGCACCAAGGTTGCCTCCAGATCGGCCACACGAACACTTAATCGC
TGGACACGATCTCCGGCAGTAGCCTGCCGCCGAGAGCTGTCTTGGCGTGCAGACAGGAAGTGGGCGCGGAAGTGGTCCGCTCGAGTGGAGATCCGCAACA
GCTCGGCTTGCGTTCGTGCAAGCTCGGCCTGCGCCACAACACGTGCGGACTCAGCGGAGGAGACTGACGCGTCGAGATCGCGGATGCAACCTAGATCGCG
CTTGTGGAGTAACGCCCTCGCGTAAATCCGCCAAGTCGTCCTCGCACAAACCCGTCGCGTCCTTTATGCAGACTGCGTCGGGTATTTTCCCGGTTCTTGA
GTAGCGTATCTCTGGGTGAAG