Description :
From Genome Similarity Track
Location :
Scaffold_50:203877- 207957
Sequence
4080 bases(100 bases per row)
CCCAAGTAGGCTCATCGTAGCCGACCCACTTAACTTTAAACTTCCGTTGTGATCGTGACGTACTCGTGGATAATGGTAGCTCATCGTCGAGAATTGCTTC
GACTTCATACTGGTTCGTACTTGTGTCTGGCTCCCAGCTGTCTTCAGGCAGTAATTCTTCGTCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGATT
AGTCTCGTCTTTGGTCTACCGCCGAGTTCGGTGACTGCCTTCACTCGTGATACATGGACTAATGGGTAGAACCTATATCCGCTCTTGTCGGGCAACTCCA
AATCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGTCCATGCCATCGGTGGGCTAGCTTCTTGGTTAGGCCCGACTTGACTCGCTCCATAAA
CAACCAGACTTGGTCTCCATCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAGCTTCATCTTCGTCATCTGCTGTGTTGGGAATGGATCTT
TTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGAAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTGTC
TGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTGGC
GTCCCAACCATGTACCAGATAAAAAGAGGTTTCTCGCCGAGTCGAATCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGTCG
GCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAGCCATTGTCTTGACTGACCTCTCTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAGCGTAG
CTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGAAATACACCACTCATAAACCTTGGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAACTG
CCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGTGCCCCAGTGTCATTCATAGCTTTAGCGATAACGAATCCCGTGAAGTGGTCCTGGAACAGC
AGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTTACACCACATTTCCCGGCGAGT
AACCTCTCAACTGTGGCTTGCTCTTACTGATATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAATACCAATCCAGTAGTAGTCGGC
TTTGACTCGGTTCTACGTTCTGACAATGCCTTGATGCCCTCCTTCGATCGAGTTGTGACAGCTATGAAGTATTTCGTCGACCATAGTTGACGGAATCACC
AATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCCAGTCGGCGAGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGCGA
CCTTGCCGGCATTCTAAGCTCGCCGGTGTGTAAGGTCCTCAAATTCACCTCTCAGGTACGCCTTCAGATCGGCCCACCTGACTTCTTCATCTTGTGCCTT
CGCGATTCGTCGTCTCCGCTCCGTCTGTACTGTCACTGGATCAATGTCGTTGGCATTCCTAGCTGTCTGGGCTGACTCCATCTGCGACCCTGTTTCGACA
TTCGGGGTCGTGTGGTTAGTCCGCCGAGTCGACGCCCTGCTGACTTGTTCGAATTCATCTCCACTGCTTTCAAACGCAGATTCTCTAGGATTTGTTGCCA
AGGCTTCGTGATCCTGACTTCCTCCTCTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAGTGAACTCGGCGTACTCGTCTACGAGTGACTGCCGT
GACAATCGGGGTTTCCGCTGGGTTGCCTGTGGCGTACAGTTCTTCGGCTACTCGGTTAATCATTCTCAGTTCTGCTTTCCTATCCGTCCCGAGAATTACT
CGTCCAGCTTTAGCTTCCAGTGCTTCTGTAGCGAGCGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTTGCTTCG
TGAGATCCTTGTGTCGAGCTAGCTCCACTTGCAATGTTTCCTTCTTGCATCATATCACCCATATGGATTGCTGGATTGCAAGCCGAGAGTCACCCACGAT
AATCAGATTGGTTATCCCTCGGTCAATCGCCGCCAAGACGCCATTGTTCATGCCGGTGTACTCGGCGATGTTGACTGTGGTGGACGACAGGTACGCACTC
GCAGCGATCTCTATGTCCCAATTCGGAAGGCGCCACAGTATCCACGAACAACTGCCATACCCGCCGTATTTAGCTGTCTTCGCTGAGCCATCAAATGACA
GCACGCATCCCGCAAAGTCAGCTGGTATGCGGGCGTATAGCAGTTCTGGGTCCATTCGAACTGTCGCCGAGTTCTTGGAGGGAGGGGCAAGGTGCTTCAA
TGAATCGTCGAGTCCGATAAACGGGGTTATCGACGCCTGGAGCAACTGGGTGAAATCTACATCTCGTTCACGTACTCGCTTCACCTTCAAATCGTAGGGC
GACAACATAACGGCAAAACTGACTGCGCGACCGTACAGCGACTTTGACTTAAACACCCACTCCAGCGTGGAGAAACGGGTGTAGACGTGTAGCGTCTTTC
CCGCCAAGAGAGTGTAGCACACTTTCAGCAATTGTAACAGCGCGACTACTTCTTTCTCGGCGGGATGATAGCCGAGTTCATTCTTCTTTAGTACGCGTCC
GCAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGCGGTTGCATCAATGTACTGCTCAGTGCCCACTCATTGGCGTACAACATTATATGTACTTCTTTTGGC
GAGTCTAAAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTTTTGAGCTCGGCGAATGATGCTTTTGCTGACGCCAGGTCACCCCCAGGGCCAAAGTC
CGTATCCTTTAGCTGATAGAGTACTGCTCCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTGAGGGCACCGAGGAACGCTTGCATCCCCTTC
TTCGATTTCGGGAAGGCGAGCTCGGCGATCGCGGCTATCTTCTTCTCATCAGCGCGTATGCCACTCGGCGTAATCTCGTGCGATAAGAAATCAACCTTGG
GTTGGATAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAACGTCTC
CCCTCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATCAAGGAAGACTGGTCTGGTTTTCCATTAGCAAATATGTCGCCGTCCGGT
CCATTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGATTCCGTCGA
GCTCAACTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCATTCGTTCGGCAAACAGTTGCCATCCTCCCTTTGGTTGAACGTATCCCCATAGAGCGTT
GTCGATTAGTCGCTGGTAAATCATAGGCGCATTCTTCAATCCAAACGGCATTCGTAACCATTCAAAGTGTCCAAGCGCACAGACGAACGCTGAGATCTGC
CGAGCTCGGCGTGTCATCAAGACTGCCCAGAACCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAGCTCTCCAATTCGGTAAGCAGGTCATCAACCA
GTGGCATAGCGTATTCCATCGGTGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGCCGAATATCCACACCATTTTTCTTGAGCACTATCACCAC
TGGCGAGGCCCAAGGGCTGCCCGAGAATGATATCAACCCAGTTCGAAGCAGCCCCTTCAACAACTCGTAAAGTTTGCTCAAGTGGCGGAGAGGTATCCGC
CGAGCTCTCTGCTTAATGGGTGCGTGTCCTTGAACGTCGATGTCGCACAATGCTCCGTACGCTGGAGGCGGCAGGGCATT