Description :
From Genome Similarity Track
Location :
Scaffold_241:20386- 21911
Transcript NameFunction/comments
g15817.t1hypothetical protein

Sequence
1525 bases(100 bases per row)
GGCCAACCTCGGTGCCTCGACCGCCTTGGTCATCATGTCCTCTGGCATATGCTTGCCCTCGCAATATTCCGGCTTCAGGATTCCTCGCTTCGTGTAATCC
CCTACAAACTTGATCCGCACATCGATGTGCTTTGCCTTCCCGGACCCTCGCCGTTCAACTACTTGAGCGCAGCCTGGTTGTCGACGTGCAGCAGCATGGG
TTGTTCGTGCTTGACACCCAGCTCACCGAGTAGCTCTCGCACACCGAGAAGTTCCGTGGCCATTACCGAGGCCACCGAGTATTCAGCTTCTATTGTCGAT
AGCGACACACCGCCTTGCTTTTTGCACATCCAGCTAATGAGCCTTCCGTCCACTGTCACCAGCCCGCCCGTGACGGACTTCCGGTCCTCTCTGTTCGCAG
CGAAATCCGCGTCGCTCTACCCAGCAACTTTCAGCAGTTCATCTGCCTTTTGGTCACCTCGCATTTGGAGCCGCAGCTCTTTCGTTCCTCCGAGGTACTG
CAAAACCCTTTTCGCTAGCTTCCAGTCATTCATGGTGGGGTTGTGCGTGCGCCGCGACGTCTTGTGCACGGCGAACGCGATGTCGGGCCGCGTGCAACGC
GCGATCCACATTATACTCCCGACCAGTAACTGAAACTTCTTCGCGGTGACAACATCGTCACTTCCAGCGACAGGCAACTTCTCACCTTCAGCATCTCGAG
CTTCATTCCATTCCGGCCCGATGGGAGCCCGCACGCCGTGTGCTAGCTCCATGCCGAAATCCCTCACTATCTCCATGATCGTAACCTCTTGGTCCAGCTC
GTATCCGTCCACTTCATCGTAATTGACGCACATCCCCAGGAACTTGATCGCTCGTCCCAAGTCCTTGACCGAGAACTCTCTGAGCTCCTCGAAAATGGCG
TCCACTGGTAGTTGCTCCGTGCCCGTGACGAGCAGGTCGTCCACGTAGACGCCGACCACCAACAGCACCACCTCACTCCATCTGATGTACACGAATATGT
CGGTCAGGCACTGCACGAACCCGATCGTCACCAGCTTCTTGTGTAACAACTTATTCCACAGGCGCCCGGCCTGCTTCAGGCCGTACAAGGCCTTCTCCAG
CTCCTGCGCGATCTCGTCGTCTCTTTCGACTCCCAGTGCCTTTCGCATCTCCTCCGAGATCACCATTCCTTGCAAGAGGTGGATGAAGATGGCAAGATTT
GCCTCCTTCTCGGCCTTGACGTACGCGTTCGGTACGCCCCCTTGCTTTGCAGGAACCCCTCCCCCCATTAGCACCAAAATCAGTATGACGCTGGTCATGT
CGACGACCGCAGCGAAGGTAATGCTGTAGTTAACACCGAACTCCTGATCATTCCCGTGGGCAACGAGTCTCGCTTTCAGGCGCTCGAGGAGTCCTCCCTC
ATCGAGTTTGGCCTTGAATACCCATTTCGTGTGCAGCACGCGTACCCCTCGAGGCATCTTCACGACTTCCCACACACCGTTTTGCTCTAGAGCCCGCAGA
TCCACGACCATCGCACCGTCTTGTG