Description :
From Genome Similarity Track
Location :
Scaffold_282:20382- 21894
Transcript NameFunction/comments
Phymu_g8029hypothetical protein PHYSODRAFT_331251

Sequence
1512 bases(100 bases per row)
CAAGGAGTGTATCGGACTGCTCGCCCAATACGCAGGTGTCGGATTCCTCGCCGGTATCATCCCCGGTGTCATCTACCCCGTGCTTCAAGGCTACCTGAAC
GCCGAGGGGACTATTGTCGTGTCCGCTACAGTGTTGGTGCAGATTCCATGGTGTTACAAGATGTTCTTCGGTGTCATCAGCGACTGCTTCCCGATCATGG
GCTACCGTCGCCGTCCGTACATGGTCATCGGCTGGGTCTTCTGTGTGGCGATCCTGTTCATTATGGCGGCGATGTCCGTCCCAGACCCGTACTACGGAGA
CGCTTCGATGCACAATatcgacgaagaagactggACAGCGGAGCAGATCGCCAGCATCAATGAACGCGCGTCCAGTTCTGCTGGAAAGTACGTCGTGCCC
ATGATGCTGGCGTCTTTCGGTTACCTACTGTGTGAAGTAGCAGCGGATGCGATGGTGGTCGAGTACGCCCAACGTGAACCTCTCGAGCAGCGTGGACGTG
TTCAGACTGCTGTGTACGCGATTAAGACGTCGTTTACTGCTCTTGGAGCCGCTGTCATTGCCTTCTTCATGAACGGAGAGGAGTACGCCGGTAGCTTCGA
CTTCTCACTCACATTCCAGCAGCTAATGCTAATCTCGGGTATTATCTGCGCTCCTTTGGTCTTCGTGTCGTGGTTCTTCCTCAACGAGGAGCGCGTGGTG
GACAAGCCGACATTCCGTGAATATATGTCGTCGTTTTGGGGAATGTTGCAGAAGCGCGCTATCTACCAGATCGTGGCGTACAAGTTCTTCTCCGGcgtct
tcaacagcttcaacattgTTTCCTCAAGTAACATCAAGTTGTACTGGGTGCACGCTACCCCGttcaacaacagcgtcaTGACTATCGTTGGAACGATGTT
TTACGCTACGACTCTCGCTCTAACAGGCAAGTACGGCCTcgactggaactggcgcacGATCATTATCATCACGATGTGTGGAGCTCTCTCGATCGACGCC
TTCATGACTATGTTCACGGTCTGGGATGTCGTTCGTAACCAGTGGTTTTGGCTGGGCGTCCCCGTTATCGAGTATTTACCCGATGGAATCCGCTTTATGA
TCGCCACGTATGTGGTCGTGGAGCTGGCTGAACCTGGCCACGAAGGAGCTCTTTACGGTCTATTGACGGCCACAACGAACCTGACGACTCCATTCGGCCG
ATCTatggcgaagctggtgaacGCTCAGTTCCACGTGTGGCTCAAGGACATCCAAGCTGACACATACATTGTGCGTCGTGACGTTACTATCACGATCTGG
ATCTGCTACggcatgaagctgctgtcgctggcgtTCCTGCCGCTGTTGCCGCGTCAAAAGGCTGAGACGCAAGAGTTAAAGCGGACTGGTGGTTCGAGCC
GTATCATGGGCATCTTCACGGTTGCTTACCTCGCCTTCGCTATTGTGTGGGCTACGATGGTGAACTTGCTGTCGATGTACGAGACGACGATGTGTTGGAA
GATCACGGGCGG