Description :
From Genome Similarity Track
Location :
Scaffold_626:20380- 24202
Sequence
3822 bases(100 bases per row)
CTGAGGCTGGATTGCGACGAGAGATTTCGATGTGGGACCACTTCGGACCCCACCGTCAAGCAGCCCAGCTGGCTCAATACGGTCCCGGCGAATTGGATGC
AGTGTTTCCCTGAATCTCCTTGGATGTCCTCCGCGCGAATGCCGACGTCCTCGTTTGGCAAAGTAATTATCGTAGCACACGCCACCGCGGATAATGGTGA
CCTCGGACTTCGACGCAGTGCTCAATCTCCAGATCAGACGTGGACACCACAGAGATAGTGTCACTATTCGACTGAAGTAGAAGGGCATTGCTCGAACAAC
TAGTTGGTGATCCCAGATAACACCCTGATACAGTACTGCGTCGTGCAGCCGTTCATCGCCCACAAAGAAAATGCGGCAAATGATAGAAATATGCCCCAGA
AGTACGAGTGCAACTACAGGAGCTGCCATACGAGGTCGAAAGCGTAGTTTGTCTCTCATGATAGGAGTGAGGGCATCCAAAGTCAGTGCCCAGTGGATCC
AAATCCACCATGTGAGCTGCAACAGGCACCGTGGGCGATCCCAGTTGTACAATATGCAGACGGACAAGGTCGCCGCAGTGGTTTGGAATGCATAGAAGAA
GAAATCGAAAGAGGTGACAAGAAGCTTGAACAGTTCTCGTTGGTAAAGGGCTGCGAATGGGACTACGAAAATCAGCGTAGACAACAGACCACCCCACGCT
TGTGCACTACCAGTACCCCTAAAATCGTAGACAATCATGGAAAATGAAAGAACGACACCAATGACACCAACAACGTACAACAGTACCAGACTACTGCCTG
CAACACGCAGAGGAAGTAAGACGTGGTTTGAGTTGAACGTGAGCGGAAACTTAATGAACATCATTTGCTGGATCATGCTCGGTTCACGAGCAACATTTTC
GTTTGGTTCGgacgcagcaacaacgtGTTTCCTTGCAGACACACTTGGAGACCGAGCTCTCCGAGCATGTACAATAGTCGGCCGGTCAATTAGCTCGAGT
TTCAATCCACATCGGTAGATAACACATTCTATCATCGACGATCTCTGCCTGACGCGAAGTGCTTGGCGTTTTCTGACGACGATCTTCGTGATTAACAGCG
AAAGAGTTATCATGGCGTTCCCAATGATATCCACGCCGGAGAGACTGAAGTGCGTGTGCTTGTTTCGATGGTTCACGACAGAAAAACTCGTGCAGCCATC
TAAGTGATCCAGCATTATCCAAAACAGCATGAAAACAAGCGGCGGAATGCCGAGGACAGTGACAATAACGAAATGTCGAATCCCCCGCACTTGACCATCG
ATAAACACGATGTTGTGAAACACGATCCAATCGATCATCATCCTGCAGAAACGAAGGTCCCAGAAGTAGGCCGAAATCATCAGTGCAGTGAGTGTTGTGG
TACAAGAGAAAAACCAAAAGTCGAATGTCCGCATTACAGGGTGCACGACGTCGTATCTCAGCGTACTAGAAGCAGGCCCATTGGGAGCCATATCGAAAGA
CTGATCACCGACAAGATTTGGCCTGTTAGTGCGTCGACTCCTGTCACGACAATATTCAGAACCATCCCGATCATGTTTGCCAGCAATAGTGGACGATGAT
ACTTGGTGAGAAGACGATGAATAACTGCATGAGCTTTTGGTGGAAGTAGCTCTCCTCTGACGGACTTGGATAGATCAATAGTTGGAAGTGGCTTAGCAGG
TACAAGAGCGTATTCGACTCCAACTGTTGCACCTGCTCCCCCAAGCATGATTTATCTCCTTGGGCCTGTTGTCGCTACTATCTAATGGCAGCAGATTAAC
AGTTCTGGAAGTCACGAAGCCACAAATGTCTTCCAACCACAGACCAATTTGGATGTGCTGGAAGCTATATTTGATAGCCTACAAATGTAGTTGCTGTGTC
ATTCCTTGGAAGTTAGTTTACATGGCAAGATCCTTGGTGCAATGTCATTGTAGCATATTCACTTGACTCGAAAGATTGTCTTTACGTGGCATTTTCTTGG
TGGAACGACGTGACAGGTGACACTcgagttcttgctgctaATGCGTTGATTTCGACTATCTGGTTAATTTGTGAACTTTGCAATCTCCCTTTCGCGAAAA
AGTTGTCGTAGCAAACCGTTCCGCGGAGAATGGCGACATCATCGTCGGAAGACGATCCGAGTCGGGCAATTAATCGCAAGCACCACAGAAAAAGTGTCAA
CGATCGACTGACGTAGAAAGGAATGGCTCGGATACTAAACTGCTGCCTCCAAACTGTCCCCTCAAAAATGACTGattcctgcagcttcgtaTCAGCAACA
AAGAAGATCTGGCAGATCAACACGATGTGGTCGAGAAGCAGGAGACAGAAGATTGGCGCTGCAACGTGGACGCGAAACTTGAGCATGCGCCGCATGGCAG
GTGTCAATGCATCCAATGTGAATACCCAGTGTGCCCAAAGCCACCACGACAGCACCATCAGACATTGCGGTTGGTCCCAACCATACAGACTACAAACGCA
GATATCTGCCGACGTGATTTGGAGAGAGTAGAACGCGAAGTCGAAGGAGGAGAAAAGAAGCTTGAGCAACCGCCGTTCGTAAAAGGCAGCGAAGGAAGTC
GTGAAGATAATTGTACACAGCAGTGACATCCACGATGCCAACACTTCGAGCTGTTCATCTGACTCCGTTTCGACTAGTTCGTTTAATTCGTGAATTAGAA
GAGCATGCGATGTAAGTAGCCCTGCTGCTCCGACAATGTAGAGTACCACCAGCAACCAGTTAGGGAAGAAGACAAGCTGCGCGAATTTCCAAGGAAGTAG
AGTGTTCGTTGCGTCGAATGTCTGCTGGAATCTTATAAACGACAAGTGCTGGACGATATCTGCTTCTCGCAAGGAAGATTCTTTTGAATCAAACTTGGGA
TCGTCGCGTGCCCACGCCACCGAGACCGTTGGCCCTCGGAGGGGCTCTAGCTTTAGTCTGCAACGATAAATTGCACACTCAACAATTGTTGATGACCTCT
TGCACCGTGACCTCAGCACTTTTCGCTTTCTGAAAACAATTCTTGCGAGGAGCAAACCCAGCGATACCAAACCATTTCCAATGACATCGAGACCGGAGAG
TTCAAAGATTCCGTGCATATTTTCGTATTTCATGATTGAAAACGCGGAGCCCCCGTCGACGTGTCCAAACATGATCCAGGCAAGTACAATGGAAGCAGAC
AAAATCGAGGCGATCAAGAAGTAGGTGAGACTTTTGAGCCCTAGCACATGCGCATCAACGCAAATGACGTGGTGATATCCAATCCAATCGATCAACATCC
GAACTGACCGTAAATCTCCGAAGTACATCGACATAGTGACGGTAATCACGCTAGTAATAGCGGAAAAGAACCAGAAGTCGAAGGTGCGCGAGACCAACCG
CACGATATCGTAACGTAGTGTTGTGATACTCCCGAGACCTACTGGCATCCAGAGTAGAACTGCCAACAACGCGAGAACGCGCCCCACTGGCGCCTTGACC
ACCGGTAATATGGCGTTTAGGCAGTAAGACAGTGCGGCGCATAACAAGACTTCTCGGTAATACTTGTAGTAGCGACGGCGGATGTATGTGTGAACACTCG
CTGGTAGAAGTCGGCCTCGGAAAGACTTGGACAAATCAACTGTCGGGAGAGGGTGAGCTGGCACGAGTGAATAGACAACGTTGACACTTGTAGTACTTCC
CTTCCTTCGGAAAGACATTGCTGAATATCGGTACGCGTGCCTAATAAATGAAGTCACGCTCGAAATTGATAAATTCCCCACAGTCAACCAAAAATAAGCG
TTCGTGCTCAGTGCTATCTTTG