Description :
From Genome Similarity Track
Location :
Scaffold_819:2038- 4020
Transcript NameFunction/comments
Phyta_totarag10863hypothetical protein

Sequence
1982 bases(100 bases per row)
CTCACAGGATCAGTGAAGAACTGGCATCGCCAACTGAGTCGTACGATACGCAACAAGTGGAGCGACTTGCTGCGCAGCTTCCAGACGCAGGACTGCGGAC
TGGGGGTTTCAGTCGCGTGGCAGTATTACCACGCGCGCAAGCGCGCGGATGGGTCGCCGCTTAAATACCTCCACCGTTTGAACGTGGCCAGGATGCGAGC
GCGCCTGAAGATCAAGGATGGTGAGCCGAAGGATCGACGTGAACACGTGGATCACTTCATTGAGACATTGGACGATCAGGATCTAGCCGATCAGTTCACG
CTGCTACGCCTCGAAGACGCCGACAAGCTTGAGGATGTCCTGCGCGCGTGTGAGCGTGCCAGGAGCCGACAGAAGAAACGTGTGTCGGGATCCAACAAGT
ACCGGCAGAAGGTAGCACCGACTCAGCCAGTTACGCCTGCACGTGCTGTACGCGCTATCCAGGTCCCGGGTCCTGACTCAGGATCCGAGTCTGAAGACCG
TGAATCGGAAGGATCCGACGGTGATCTGCGCCAAGTGTacatcgctgctgccgctgatCCAGACCAGCAGCCTGCAGACGAAGCGAGGAACCATGATGGG
CGCCAGCATGACCGGATTGTAGAGGACTCGGCCCCCCAGGGGCGCCGATCTCCGACCGGACACGGTGGCTCGGGACGCACTCGCTGCTCGCACTGCGGAT
CCGTACGCCACACCGAtcttggctgctggagacgtcTGACCTGTCAGTAGTGCGGAAAACCAGGGCACCCGTCAGATCGCTGCCTGTTTGTCTGCCGCGG
ATGTGGTGAACTCCATGACGTGGGCAAGTGCCCGATGGAAGAGTTCTACAACATGATCCGTCAGTGGTACAATCCGAACAAGCATGCGGGTATGTTATCT
GAGTCTGCTGAGAAGATGTTAAACTAGAACGCTCGCCGGTTTTGGATCCGGTACGAGCCGAGCGTTCTACGTCATTCATCTATGCATTTGTGGAAAAAAC
GATCGAGAGATCCTGTTAGCAACAAGCAAGCGGATCTATTCAGTAATACATGTGAACTGCATCAACAACATACTCCAGTGATCTCAAGTCTTCGTCAAGT
CGATGGGCTCCAGCGATCCGATGTCATGGTGGCCCTTGATCTCCTACCCGGAGAGTCTCGGGGCTTCTGGAAATATTACGCACCGGGGAAATGGTTCAAA
CAAGCCAAGGCTACAGGCAAGATCAACAATGAGAAGGTCATCTTATGCTTAGACTCCGATCTGAGGTGTCCATTGTGGACACCGCCTTTGCTCGTAAGGT
AGGATGCTGTATTGGCACAAATCAGAGTCAAGAGTGCGTCGGCATTGGTGAGAATGTGTACATGACGGACGGGAAGACAAGAGTCAAGATCACCTTGGCA
GGATCCTTGGTGTATTACTTCGACACTTGGGTCGGGTCCTTAGCTGGTCAGCATGCGATCCTTggcatggacttcatggttCCTGTTGGGATCCGGTTGG
ATCTTGGCGACGGATCCTTGTGCTTGCCCGACGAGGTCAGGATCCAAATCAGCGGAcgtcgccagctcttcaaTGACAAGGTACGGGTTTTGAAGGTTGA
TCAGCATACGCAGATCGAGGTCGGAAAGTCCGCCGAGCTGCCGCACCGCCTGTGGACATCAGACACTGAGAAGCTGTGGGTTGCGCGGGGTGAACGGTGG
GTGCCGACGATGATCAAAGGTCCTGGCAGGTCACAGTACCTGCAAGTCACGTACATTGACGAGAAGGCACTTATCCTCCAAGGCAACGAGACGATCGGCA
TGTGGCTTGCCGTAGACCGTGTTTCCCGGAGCCCCGGGTTCGTCTCGGTAGGATCCCGCCGCTACATGGAGTGGTAGAACCTCGCCTTGCAAGCCACCGT
CGGGGAGTCCGAGCTGGAAGAACCGACGGAGCCGGAGTACCCGTGGGAGACTGCAGTGGAAAGACCGGAGTATGTGACGCCG