Description :
From Genome Similarity Track
Location :
Scaffold_1469:2038- 3932
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1469-snap-gene-0.6NAD-specific glutamate dehydrogenase
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_1469-abinit-gene-0.10Glucose regulated protein /BiP

Sequence
1894 bases(100 bases per row)
CAACGAAGACCTGTTCAAGAAGACCCTCGGCCCAGTCGAGAAGGTGCTCAAGGACGCCGGCTTGAAGAAGTCGGAGGTCGACGAGATCGTGCTCGTCGGC
GGCTCGACCCGTATCCCCAAGGTGCAGCAGCTCATCAAGGACTACTTCAACGGCAAGGAGCCATCGCGTGGTGTGAACCCAGATGAGGCTGTTGCCTACG
GTGCCGCTGTTCAGGGCGGTATCCTCGGCGGCGAGCAGGACGAGCTGACCAAGGACGTGCTCCTCATCGACGTCGTCCCCCTGTCGCAAGGCATTGAGAC
TGTCGGCGGTGTCATGACCAAGCTCATTAACCGCAACACTGTGATCCCAACGAAGAAGTCGCAGACGTTCTCTACGTACCAGGACAACCAGCCAGCGGTG
CTGATCCAGGTGTTCGAGGGTGAGCGTGCGATGACCAAGGACAACCGCCTTCTCGGCAAGTTCGAGCTCACGGGCCTCCCACCCGCTCCACGTGGCGTGC
CACAGATCGAAGTGACCTTTGAGATTGACGCGAACGGCATCCTGCAGGTCGGCGCCGAGGACAAGGGCACGGGCAAGGCTGAGAAGATCACGATTACAGC
CGAGAAGGGCCGTCTGTCCCAGGAGGAGATTGACCGCATGGTCCAGGAGGCCGCTGAGAACGCCGAGGAGGACAAGAAGGTGAAGGACCGCATCGACGGC
CGTAACGGCCTCGAGGGCTACCTCTACAGCCTCAAGAACTCGGTCGAGGACAAGCTCGCCGACAAGATCGAGGAGGACGACAAGGACACGGTGCTCAAGA
GCGTGCAGGACGCCATGGACTGGCTCGAGGACAACCAGGAGGCCGACAAGGAGGACTTTGAGGCCAAGCAGAAGGAGGTCGAGAAGGCGGTGAACCCGAT
CATGGCCAAGGTGTACCAGAGCGGCGGCGGCGCGGCCCCAGAGGGCGACGACGAGGACGAGGAGGACGACCACGACGAGTTGTAGACGGTCGGTAGTGTC
TGATTTTCCATTCTCTCTTACTGCTAAACACCCCAACAAAAAAACGAAATTATTTTGGAAATTGAGTGGCTGGTTGCATGTGTGTTCAGATCCAATAGGC
TCGTGAAGATGGCGAGCTGTGGCGCCAGACAAGACGCTTCGAGCATTGATACAGTATTCCAATGTTGCTGCTCGTCTTTGAAGCAGTGAGAGGAGACGGA
TATCAGGATATGAGGGCAGTCATCACCACCTTCTCCAACACGTCAGTGTCTGCGGATGCCTCTTCGCATCTGCTTGTATGTACATACACAGGCAGAGCTC
ATCTGTGTACGAAGTGCAGTTCACTTGGAACAACAGAAGCTCATCAAGAGCGAAGTGGTGGCGTCTTGGTCTCCGTTTGAATTTGCTTTGGAAGATATGC
GAGGCTACGGTCCAGACTCTAGGAGTGTTTGTCACCATCTACTTTTTTTTGCTTGTGCTGCGCTTGTCATTTTCCTGATTCAACCAAATCACGCGCTTCG
CGCCCCAGTCCGTGTGAACCATTTGAAGCGCATGCGCCATACGGTGTGAAAAGCGCTGTGTGGAAGCACCAACGCCGTCTATGTGCGAGATATTCCCTGT
CTTGTACCTGGGCAATACCTGTCTTCTACTTGGATATCCTTTGGACAACATCGTAGCTTTTCCAAACGCCAGATTCACCTCCTCCTCTCTCATTGGTTCA
AAATACAAATACAAATCTCTGATTGGCTGAATTTGAAAAGTTGAAGTTGCAGTCTATTTTTTTTGGTAAGGCGCGCGGCAACGCGGAACGCAAGACGCGG
AACGCAAGACGTGAGCGAAGCAACAAGCGAAGGAAGGCTCGTCTCGGTATGTGTATCCGCCACAGGGTTCCACTCGCGACTGCCCGTCCCGGAT