Description :
From Genome Similarity Track
Location :
Scaffold_141:2038- 3717
Transcript NameFunction/comments
Phyke_g4960hypothetical protein PHYSODRAFT_485789
Phyke_g4961hypothetical protein PHYSODRAFT_426370

Sequence
1679 bases(100 bases per row)
GTTTCGCTTGgtattgttgttgtgcttACTGGCTTCCGGGACGGCAATGAGATGTGTTGACCATGCAAACGGCTCGGTAACGAAGTAACCCGCGCGCAGT
ACACAAGACTCCACACTTTGGACTGTCCGAATcgagctccttcagcatgGGTAAGTGGCGAATCAAGTATCATGTTAAGATATCCAAGACACGCTGGCTG
ATGTTGTGCTTCAGGTGTGTTAGCTTGTTACACGTCGTGAACAAGAGGTGCTGAATACTGGCGATTGTTTCCTGAGTCTGGGTGTCGAACGAGGTCAAGT
CCAGTATCTCCATGCTGTTCGAAGCCTCGTAACCACTGAGCGTCTTGCTAACCTTGTGATCTTCCTGGTTTGTATTGAAGATGCAATTGAACCCCTTGTT
GGTCGTACTCATGTTCCAGGAACCCCGGTCGAAAATCCAGTGATCGGTGGAGTGAGCGTATCCATTGGCGTGCTGCGCGCCACCACGGCGAAAAGAGTGT
GACGTGAGACGCTCAGTTACCCCATCCTTCTTCGCAATCCGCTCAAGAACACGGTTGACGTAACTGTGAACACCAGGCGTGGCCATTGGGGCATTGGCAG
TCGAGGTGTCGGGCGCAGATTGTACCAGTGACATTGTTTCTGGATGATTTAGCAGGTCAATTAGCGGGAAGGATGGTGTGAGCGTGGTGGATGTAAGTAG
TTGCTGATCCAGAAGATAGCTCAGTAGAGCAGGCATCAGTGACGACTGGGTGATCAATGCGAGCGCAATAGCAAGTATCGGACAGGTTGCAAAGTCGTCG
TCAGAGAAAAGAGAGAATCCTTGCTCTTCGGCCATCTTGATCCGGATGAATCTTACAAAGAAGATGTCGCCTGAGCCGATGGATAGGTTAGACTTACGAA
GCAGTGTTAAATCTGACGCTCGGCCAAAAAGGAACCAAAGCAGGCATAGTAGCGCCGCATCTTGATAATCAGTCGTTGTGGAAGCAGTAGAATACAAATG
CATGACCATTTGCTTGAGCGCCTTCTTTGTACATGCTGGGGCTTTATTGACAAAGTCTCCAGACTCGCGCTTCAAGTAGTATCGCTCTAGTGTCTGACCC
TTCTTGAGCAGATGCGCATCGACAGCGgcatgatgctgcagaaactgaCCCAGAAGTCAGTTCTTCGCCTGGCGGAAGTACTGCATGACCGAGTGGCGCG
CTAGCAGCTTCCCTTTGTGATCCTCCTTGAACACCAGATGCATGCCAAACTTGTCCACTACCGCTTCCAAGATAAGTGGAGAATTTTTACGCAGCATGCA
CATTTTTAGATACTCCCAGctcacgtcttcttcttctaagAACTTCATGAAAGAGCGCGCCGCGCTGTCACGAGTATGCTTCGTGTTGACAGTAGCGAGG
TCGTCGAGGCTCATCTTGCGGGTCGGAGGATTGTCGGTAGTTGTGAATTATACGCAAAATATACGAATGACTGCTATTTTGTAAAGGCATACCAATAAct
ttgctgtctccaacCCGATATGTCGGAGTGGCAGCACGTATTTGACTCTCtttgtgattggctgaaacgCAGGATAAATGCTTTCTGATTCGCTAAAAAT
CGAATCAACACTTCCTATTGGCTGAACCTCACAATAGTGAATTTAAGTAAGGTCGGAGaagtgatgatattcatccata