Description :
From Genome Similarity Track
Location :
Scaffold_98:20374- 23684
Transcript NameFunction/comments
Phyra_96690serine protease family S28, putative
Phyra_83844Drug/Metabolite Transporter (DMT) Superfamily

Sequence
3310 bases(100 bases per row)
GACGGCAACGCTCGCTGCACTGCTGCTGGTCGCGGCGCTCTCCGCGAGCGCCCAGGGCTACACGTTCCCCTCGCATGCCAAGGACGGGCGCCTATGGCGA
TTAGTGCAGGCGGAGGACCAGATGCTGTTCCAGGCGGGCGCGCAACAGCTCTGGTTCAGCCAGCAGGTGGACCACTGGGCCTCGGACAGCAACGCCACGT
TCCAGCAGCGCTACTACCAAGTGGACAAGTTCTGGAAGGCGCCCAACGGTCCCGTGATCCTCTACATCAGAAGAGAAGGCGCGCTGGAGCAAGCCCCCGC
CGGGTTTGTGCATGTCATTGCCCAGAAGTTCGGCGCCAAGGTGTCTACTGCTCGCAACGGCGTTGAAAATGAATAAGCTTGTCAGACTCATAAGTATACT
TTGGTGCTTGTGTTCTGCTAGATCCTGGCTTTGGAGCACCGGTTCTACGGCAAGAGCATTCCGAACGGGGACCTCTCGACGACCAACTACCGCTACCTGA
CGGTGCAACAGGCGCTGGCCGATCTCAAGCACTTCAAGGAGAGCTACCAGAAGCAATTAGGGGCAGAAGACGCCAACCAATGGATCGCAATTGGGGGGTC
CTATCCGGGAGCTCTGTCCGCGTGGTTCCGTGTTGCCTACCCGGATACGACGGTAGCGTCGTTGTCGTCGTCGGGGGTTGTGCAGCCGGTGTACAAGTTC
CACCAGTTTGACGAGCAGGTGGCTCTAGCTGCGGGTCCTTCGTGTGCTGATGTGCTGCGCATGACAACGGCAGCTTTCGAGAAGGAGATTGCGAGTGGCA
ATGCGACCACGGTGAAGGGGATGTTTGGCGCAAAAGATTTGGCTGACGCCGATTTCTTCTACATGATCGCGGACGCTGCTGCGATGGCTGTGCAGTACGG
ACACAAAGATATTGTGTGCGTCAGCATGGTTGGTGCCTTTGAGCGCAACGATTCGCTGGTTGACTCGTTTGCCAGTTTCACGATCGACATGTATGGCGCT
TCGTTTGGCAGCGGATGCTTCTACGACACAAAGTGTCTTGCACACGACAGTGCGCGCTGGGGGGACGGACGCTCGTGGCGCTGGCAGAAGTGCTCGCAGC
TCGCGTACTTCCAGGTTGCCCCCAAAGAGAAAAGCCTGCGCGCTGCAATGGTAGACCTCGACTACCACCTGAAGCAGTGCAGCCTTGTTTTTGGCGACGT
CGTGCATCCGTCCGAGGGCGTGGAAGAGATCACCAAGCTGTACGGTGGAGACCACCCGGATGGCCACAAGATCTTCTTCTCAAACGGTGGGGATGACCCG
TGGCAACGTGCTTCGGTGCTCGACACGCTGTCTGACGATGAGATTGCTAACTTGGCCAAGTGCGACTTGTGTGGCCACTGCGGTGACCTGCGTGCCAATC
CGAATGTGCCCGAGCCGTTGAAGAAGCAGCGCGAGCAGATTCTCGAGTACCTGGCCAAGTGGATGGGTGTGTCTGATGCCGTGGAATTCGTGGAGAACGT
TGTGCACGAGGCAGTCGCTATTCCTCATCACGCGCAAGACGATGAAGATGGTGCGCAGGAGATGGCGGGACTGCAACTTGCCGGACTGCACAAATCGTCG
CCACTGGTCCTTATTCCCATTGTTGTCGCGTTCCTTGCGTTAGCGGGGGTCCTGCACGCTGATGTTGTTCGCGACGCTCCGGGGCGTATGGATATGATAC
GATACCGGCTTGCGCACACGCACGAGTTTTGAGAATTGCGGCAATACAGACGCCCCAAAGCTCGTACGAACCGAGGTGGGCTGTAAGAGTTAGAGGCTTG
TAGCCTGCCTGACGTACACTACGCTCGATGATGACTCCGTGCTTGTATCTTCAACTTTTTTTATTTTTCTCGAAAATGAACATGCACGTCCATTCTAAGC
CTGTGTCTATAGCATACGCATGAATATTGAGGAGTCTCGCACACTTGCGTGGTGATCAGCAGCGGCCGAGACAGTCTTATGCGCTCTGCGTCTGCGCCTT
GGGTTTAGCTGGTGCGGGAAGCGTGGACTGGCCCATTGTCTCCTTCGTCGAGATGTAGGCGTACGTGGCGCCTCCAATAGATACAACGATGATGCCGATG
GCCTTTTGCACAGTGATCACGTCGTTGTTGATGAGGATGGACATGACGATCACAACCACCTGCTTCATGTTGCCGCACACGCACAGCGTCACCGGAGACG
TCACCTTGTTGGCCATGAAGCTCGTGACGTTTAGCATGAAGCTGATGATGCCGGTCAGGATGAACCAGAAGCTAGCTGACGGCACAACCTCCCAGTTGTT
CATGGCCGTGTTTACCTCGCCCGTCAAGAACATGGTGATCAAACACCAGCAAGCGGACAGCGGTGCCTGGTGCAGGATGAGGTCCACCGGGTGCAGCTTC
AGGTCTCCGCTCAGGAACTGCAACCGTCACAGCAATGCCATACACGAGTCAGTTACCTAGATCACTCGCAAAGCAATACAATCCCGCCGTACCTTGTTGG
AGAGCACTGCCTTCAAGCCAGCAAAGATAATAGCCACGACCGTGATGACGAAGCCCAGCACCGTGCACGAGTTGTCTCCCGTGCACGCCAAGTAGACGCC
AAACGCCACGGGCACCAGCGACAACTTGCGCTTGAGCGAGTACGACTTGCCGAGGATGAGCATGCTCAGCACGACGACCACCGCCGGTACAAGTGCGCGC
ATGACCTGGTTGAACGAGATGGACACGAGCCCCAGACTCCAGTTGCCCGTGATGATGTTGCTCACGAAGATGAGCGAGAAGTAGACCATGAGCTTCTTCT
GGCCGGGCTTGAGCGGCTTGCGCTCGATGCCCTTGTACACGTGGATATACAGGAAGGCGCCCAACGTGTTGCACACCATGTGCACGAACGTGAGCGTCAC
CGGCAGACGCAGCGCGCCCAGCGCCTTCTTGTTCCAGAACGTGACGCCGATGTTCTGCGTGAACCACATGCTGAGCCAGAAGACCACGACCGAGGGCGCC
ACGTACGACGTCTTGGCCGAGGCGGCCGCCTTCTGCTTCTTCTTGAGCTCCAGGTCGTCGGCGGCCTCGAGGTCCACGTCCATCTGCTTCACTTTGCTCT
TGCTTTTGCTCTTGTTGTCGCCGTCCTCGTCCAGCAGCTGCGTCGTCTCCGTCGTGGACTCCTCGTCGTCCACCTCGGGCCGCACGTCTACGACGGACAC
GTGGCCGCCCTTGCCGGACTGGAGGAGGCCGGCGCCACCCGACTGGGTGCGCGGCCGCGAGCTGAGCGTTTCCAGGGCCATGGCGAGCGGTGCTGCTTGA
GTGCTGCTGG