Description :
From Genome Similarity Track
Location :
Scaffold_32:203728- 205492
Transcript NameFunction/comments
g6892.t1hypothetical protein

Sequence
1764 bases(100 bases per row)
AGACCATGCAACTGCGCTTCCCACTGCCGGCGGGTTACTTCGCCAAGTTCGATCTGCTGCCCACGGAGGTGCAGAGCTACCGGACGCTGGCGAGCGACAT
CGTCCGTGAGACGAAGCGGGACTTGGACCATTACGTCAAGGACGGACGCAATTTGATCGACGCGCACACGTGGAAGCTGGCCAAGTCCAAGGAACGATTG
CACTGCTACCGGAAACGCAGTACGCAAAACGCGGCGCACCAGCTCGGACTGTACGGTACCGAGCCGTCGAATGGAGGCTCGTCCGCTTCGAGCGGTAATG
ATTCGTACGGATACTCAGCGCGGTCGCGTCCGTCGATGAGCGTCACGAGCTCTCACAGTCGTTCCGGACACGAAGACATGGGGCATCTGTCCGTGTCGAC
GCGGTCTTCAGATGACGGCGAACCGAGCCGCAAGAGCATTCAGCCGATGGTGATCGGCTACGGCATCGTGGATGGCTCCGTGGACGACCTGGTCTACGGA
CTCTACCAGTCCACGACCGACGAGATGAAGACTCTCTCCGCCTTCCTCGGAGACGACTCGCTCATCGACTGTGCCGCGTTGAAAACGATTCGTCAGACTC
GGTCGTCATACCTCGGCCTCAAGTGGAAGCTGTCCCGCACGGTGGGAGGCAATCGTGACTGTTGTTACATGGAGTACGTGGGTGTGTCGGAAGACGCTAA
CGGCCAACGCTTTGGCTACCACGTGCTGGAGTCCGTTGCGGTCCGCAATTGCCCGCACTTTGATGACAACTCGATCGTGCGCACCAACTTGTCCTTCTGC
TTCATCTTCCGACCGGGCAAGCTCGCTGACCAGGTAGAGGTGTTTATGGAGGGTGCGTACGATTCTTCGGCCGACGCGCTCACGGTTGGCGGAGTGGGCG
ACTACCGCAGCGCGATGGACATGTTGTTTAACCTTCCGACGTCGCTCGTCGGAGCCGAGGCCAAGAAAATCTCGGCAATGGTGGCTAAGCAGTCAGGTGC
GCTGCGTGGAGCAAGCAGCAAGAACCAGAGCGGCAACCACTGCTCCATCTGCCGCGCCAAGTCGGGCCTGTTGTCTTCCCACACAAACTGCCAGACGTGT
GGCGCTGTCATTTGCAGCAAGTGCCGCATTCGCAAGGTGACGTTTTCACGCCGAGGCAAGATCAAAGTGTCGTGCTGCAAGATGTGTATGGTCATGGTGA
AGGATCAGTCGCCGTTCGCGGGAGAGCAGCTTGAGCAGCAGCCTGTGAAGCCGAAGAAGGCGTCAAGGGACGATGGCCGCAGCAGGAACGGCAGCAACAG
CAGCAGCAGCAACACTAGACTGGACGTGATCAACGCGTCCGTGTCCACTATGTCGCTCACGGACTCGGAATACTCCGAGTCCTGGCAGTCCAGCTCGGCG
TCTTCGCTGCAGTCCGACCTTGATGACAGTTTCTACAACTCGACCGGGCCTAGCAGTGCCATCGTCTCAAGTGACAGAAAGATGCCGGCGCTGATGGAGG
GCGAGCTCCGTCCGCCACCTCCCAGTTATTACCAGAGCGAACAGCAGCGTCAGTACGAGCAACAACAGTATCAGCAGCAGCAGTTCCTGATCCGACAGCG
AATGAAGCAGAGTACCGACCCCAAAATGCCTCCCATGCCAAGGCAGCGACAGCCCGCCACTCGCGAAGGAATGTACAACCAAATGCTAGAGCTGCAGATG
CAGGCCGAGCGGGCCTACAACTTGACCAACCAGAACGCCACCATGATGAACACGAGGCGATAGC