Description :
From Genome Similarity Track
Location :
Scaffold_54:203723- 204828
Sequence
1105 bases(100 bases per row)
TCGAGCGAAATAAAGCTCGCTTAGTTGTCATCGGGTGCCAGCAAATTAAGTTCATCGACTTCGACGACGTCTTCGCGCCTGTGGTGCGCTTGGAATCATT
CAGAGTGCTGCTTGCAATTGTGTGCATTGAAGACTTGGAGTGTGAGCAAATGGACATTGAGACCGCTTTCCTGAACGGTGTGCTTGAAGAAGAAGTGTAC
ATGCAACTCCCACAAGGGCTAAAGGTCCCCGGTCAAGAAGGTCTGGTGTGCCGCCTGCTAAAAAGCCTATATGGCCTCAAGCAGGCACCACGCGCATGGC
ACAAGGCGTTAGTTCAGTATCTCACCACTGCTGGATTTGAAGCTCTGCAGTGTGAAGCCTGCATTTTTGTTCGGAGCACAGGCAGCAAGACGCAGATCGT
AGCCATCTATGTGGACAACTTGATGCTGATCGCTAAGACTCGGGGTAAAGTTGCTGAAATGAAGGCCGGCATCCAAAAAACATTTCGTGCGAAGGACATG
GGCCCCGTCAGCTACATTGTGGGGATCAAAGTAGTCCGTGACAGGGGTACAACGAAAGCTGTGGATCAATCAGCAGCTAAGCGCAGACAACATCGTGAAC
CGGTTCAACATGCAACACGCGTTTGCTACTAAAGTACCATCGATTCCAGGGAAGAAGCTGCGGAAAGTTAACGGCGCTGATGCAACCGGTGATGTCATGA
GTGACATGGCAACGAAACCCTTTCGACAAGCTGTTGGAAGTCTAATGTATCTGATGATCGGGTCGAGGCCTGAGCTTGCCTTCTCCATTCAGGATGTGGG
CCGATTTCTCAATGCTTACGCTAAACCACACTGGGAAGCTGTCAAACAGATCATCAAGTATGTCAAAGGAACTACAGCTCACGGTTTGGAGTTCAGTGGG
TCCGACATCAGCTTATTCCGATTCTGACTACGCTGCTGACGAAGATGAGCGAAAGTCTGTATCGGGATATGTTACCTTCATTGGTAATTGTGCAGTTACT
TGGAGCAGCAGAAAGCAACGCATTGTCGCCCAGTCAACAGCGGAGGCTGAATACATCGCGCTCGCCCACTGTACACGCGAAGTTCTCTTCATTCGGCAAT
TGCTG