Description :
From Genome Similarity Track
Location :
scaffold_43:203722- 205102
Sequence
1380 bases(100 bases per row)
CTCATGATTCTCACGTAATTAGGCGTGCAACCTATTGGGAGACAAGAAGCAGGAATCTTGCAGAGTTCATTTCGCACATAGTAATCATTTAAGGCGAGAA
CAGCACGTTTTAACGACGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAATCCTCGCATTCCAGAAATAATTGAGCCGTCATCTTTATATTTTTCGTTATTCTTACAAATAATAG
GGATGCCAAGATACGACTCCAAAAGTTGACGGAATTCTGTCGCTCGATGTGCTTCAAACGAATAATATTGTTGCATTGCATTTGCAACATTTTCTGCAAA
AGTCACGTCTTCACCGGTTATTTCAATCTTTCCTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNagggtgcttcattgggaagcgtggccttcgaacgGACCTTGCTaatgtcaaggccattgtagattggccgatTTTAAG
GAATTAGAAGGACTtgtgtaagtggcttggtcttgccctaagcagcgttccacgctatcaaagtcaagaagcgtgacacc