Description :
From Genome Similarity Track
Location :
Scaffold_22:20372- 21566
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_22-snap-gene-0.12DEAD/DEAH box RNA helicase

Sequence
1194 bases(100 bases per row)
CAGCGGCGGCAGTGGCGACAACTCCGATGGCTTCGCGGCGCTCGGCTTCCACGCGCCGTTGGTCGCGGCGCTCGCCGAGATGGGGCTCACGGCGCCCACG
AGCGTCCAGCGCAAGAGCGCCGCCGCGATTCTCGCGCGCAAGGACGTGCTCTGCACGGCGCAGACCGGCACGGGCAAGACGCTCGCGTACCTCGCGCCGC
TCGCCGAGATGCTCCACCGCCACGAGTCGGCGGCCCGCGCCACCGCTGCTGCTGTCTCCACCGACGCGCCTCCCATCCAGACCAACGCGCTGATCGCGCG
TCCACAGATGCTGGTGATCGTTCCGAGCCGCGAGCTCGCGCTCCAGGTCGGCGACGTCGCCAAGCGGCTCGCGCACGTCACCAAGTTCGCGTCGTGCACC
GTGACGTCGGGCGAGCCCAAGCGTCGCCAGCAGGCATCCCTCCAGCGCCCGCTCGACATGGTCATTGGCACGCCCGGACGGCTCGCCAAGTGCATCGCCA
AGGCCGACTTCTTCGTCTCGCGCGTCACGACCGTCGTGATCGACGAAGCCGACACGCTGTTGGACGCCAAGAGGGGCTTCCGCGCGGAACTCGACGCTGT
GCTCAAGCCCATCCAGGCCAGCGCCGCCAAGCGCAAGACACCGCTGCAGATGGTGCTCGTGGCCGCGACGCTGCAGCCGCCGCTCGATACCGTCGTCAAG
AAGAAGTTTGGCGACCTCGGGCTCATCAGCGACGACAAGCTCCACCAGACGCCGACTCTGCTAAAGGAAGAGTTTCTCAAGGTCTCGGCCGAGACGAAAC
ACTCGGCGCTGCGCGAGGCGCTCCACCAGCGGCGCGTGCGCGACGCCAAGACGATCGTGTTTTGCCGCACGGCCGCGAGCTGCAACGCCGCCGACCACNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCGAGCACGGCTTTGCCTCGCGCTGTCTCCACGGCGACATGCCCACGCCGCTGC
GCGAGGCGTCGGTCCGGGCCTTTGGCGACAGCGTCCAGATTCTCGTGTGTACGGACCTAGCGGCGCGCGGGCTCCACTTTGACGCCGTCCAGCACGTCAT
CATGTGCGACTTCCCGGCGTCCGCCGTGGACTATGTGCACCGCGCGGGGCGTGCCGGGCGAGCGGGGGAAGTGGGGTACGTCACGAGTCTCGTG