Description :
From Genome Similarity Track
Location :
Scaffold_88:20367- 21453
Sequence
1086 bases(100 bases per row)
TCGACTTCACCACACGGGGCCCCAACGTTCTGCGTTAGGAAACCGGACGGCTGGAGAATTGTCTATGATTATCGAGCCATAAACTTGAATACTGTCCGTC
GAACTCTCCCAATGCCACGGAAGGATGTGATTCTGGAGAAAATGTAAGGCTGTCACTACTTTTCGTGTTTGGACCTTTTGAGTGGTTACTATCAGTTCCG
AATGCATGAGGACGGTATTCCTTACACAGTGTTTCAAACTCCGGATGGCTTGTTCGAGTATTTAGTGGTGCCGATGGGTCTATCGAACGCTCCCGCAACG
TTTAACGCTGGGATACGTGCGGTTCTGGCGGATCTTCATGATGTTTGCCAATCATATTTTGATGATATATACGTATACGTCTATACGAAGAGTCTCGACG
TCCACGATCATCTTCGAGCACTCGACCGAGTATTTGCCCGACTACACAAGCACAAGTTCTATGTGAAGTTGAGTAAGTGCGTGTTTTGCGCTCCATCCAT
ACCTTGCCTGGGCGACATCGTTGGTCGAGAAGGCGTAAAGATTAGTCCAGCAAAAGTTCGAGTGATCCGACAATGGCCACTTCCGAAAACAAAATCTAAG
CTACAATCATTTCTCGGGACAGCCACGTACGTCCAACGTTTCTGTGATGGCTTCGCTGTGGATGCTGGACCACTTTTTGATTTACTTAAATCTACTTCCA
AGATACTACCGTGGAATGACAACCTTCGCCAACATTTTGAGTCCTTGAGAAGAATTTGCCGTACCCCAGTGCTAGGAATCGCGGATTTTACTCAACCATT
TTACTTACGGATGGACGCATCAGATTTTGCGATGGGAGGTGTATTGTTTCAGAAGGAGTTTCAAGCTGGAGAAGAAACCGAGAGACCAATCGCATTTGCC
GGCCGGAAGTACAAAGCAGCAGAGAAAAATTACTCGATTCGGGAAAAAGAGCTTCTTGCGATTCTATTTGGCCTTCGCACTTGGCGTGTTTATCTCTTAG
ATCATCCGTTCGTCGTCGAGACGGATCACAAGAGTCTGGAGACCGTGTTCAAACAGAAGACCATCTCTCGAAGAATAGCGAGGTGG